Search
Advanced Search
Metrics info
Average Rating (0 User Ratings)
    • Currently 0/5 Stars.
    See all categories
      • Currently 0/5 Stars.
      • Currently 0/5 Stars.
      • Currently 0/5 Stars.
    Rate This Article
Share this Article info
  • Bookmark: StumbleUpon Facebook Connotea CiteULike Bibliography

Open Access

Research Article

Evolution of hydra, a Recently Evolved Testis-Expressed Gene with Nine Alternative First Exons in Drosophila melanogaster

Author Summary<p>Similar groups of animals have similar numbers of genes, but not all of these genes are the same. While some genes are highly conserved and can be easily and uniquely identified in species ranging from yeast to plants to humans, other genes are sometimes found in only a small number or even in a single species. Such newly evolved genes may help produce traits that make species unique. We describe here a newly evolved gene called <i>hydra</i> that occurs only in a small subgroup of <i>Drosophila</i> species. <i>hydra</i> is expressed in the testes, suggesting that it may have a function in male fertility. <i>hydra</i> has evolved significantly in its structure and protein-coding sequence among species. The authors named the gene <i>hydra</i> after the nine-headed monster slain by Hercules because in one species, <i>Drosophila melanogaster, hydra</i> has nine potential alternative first exons. Perhaps because of this or other structural changes, the level of RNA made by <i>hydra</i> differs significantly between one pair of species. This analysis reveals that newly created genes may evolve rapidly in sequence, structure, and expression level.</p></sec></div> <span property="dc:date" content="2007-07-06" datatype="xsd:date" rel="dc:identifier" href="http://dx.doi.org/10.1371/journal.pgen.0030107"></span> <span property="dc:subject" content="Evolutionary Biology"></span> <form action=""> <input type="hidden" name="journalDisplayName" id="journalDisplayName" value="PLoS Genetics" /> <input type="hidden" name="crossRefPageURL" id="crossRefPageURL" value="/article/crossref/info%3Adoi%2F10.1371%2Fjournal.pgen.0030107" /> <input type="hidden" name="metricsTabURL" id="metricsTabURL" value="/article/metrics/info%3Adoi%2F10.1371%2Fjournal.pgen.0030107" /> <input type="hidden" name="doi" id="doi" value="info:doi/10.1371/journal.pgen.0030107" /> <input type="hidden" name="articleTitleUnformatted" id="articleTitleUnformatted" value="Evolution%20of%20hydra%2C%20a%20Recently%20Evolved%20Testis-Expressed%20Gene%20with%20Nine%20Alternative%20First%20Exons%20in%20Drosophila%20melanogaster" /> <input type="hidden" name="articlePubDate" id="articlePubDate" value="1183705200000" /> </form> <div class="horizontalTabs" xpathLocation="noSelect"> <ul id="tabsContainer"> <li id="article" class="active"><a href="/article/info%3Adoi%2F10.1371%2Fjournal.pgen.0030107" class="tab" title="Article">Article</a></li> <li id="metrics"><a href="/article/metrics/info%3Adoi%2F10.1371%2Fjournal.pgen.0030107" class="tab" title="Metrics">Metrics</a></li> <li id="related"><a href="/article/related/info%3Adoi%2F10.1371%2Fjournal.pgen.0030107" class="tab" title="Related Content">Related Content</a></li> <li id="comments"><a href="/article/comments/info%3Adoi%2F10.1371%2Fjournal.pgen.0030107" class="tab" title="Comments">Comments: 0</a></li> </ul> </div> <div id="retractionHtmlId" class="retractionHtmlId" style="display:none;" xpathLocation="noSelect"> <div id="retractionlist"></div> </div> <div id="fch" class="fch" style="display:none;" xpathLocation="noSelect"> <p class="fch"><strong> Formal Correction:</strong> This article has been <em>formally corrected</em> to address the following errors.</p> <ol id="fclist" class="fclist"></ol> </div> <div id="articleMenu" xpathLocation="noSelect"> <div class="wrap"> <ul> <li class="annotation icon">To <strong>add a note</strong>, highlight some text. <a href="#" onclick="toggleAnnotation(this, 'public'); return false;" title="Click to turn notes on/off">Hide notes</a></li> <li class="discuss icon"> <a href="/user/secure/secureRedirect.action?goTo=%2Farticle%2Finfo%3Adoi%2F10.1371%2Fjournal.pgen.0030107">Make a general comment</a> </li> </ul> <div id="sectionNavTopBox" style="display:none;"> <p><strong>Jump to</strong></p> <div id="sectionNavTop" class="tools"></div> </div> </div> </div> <p xmlns:xs="http://www.w3.org/2001/XMLSchema" xmlns:xlink="http://www.w3.org/1999/xlink" xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:aml="http://topazproject.org/aml/" class="authors" xpathLocation="noSelect"><span property="dc:creator">Shou-Tao Chen</span><sup><a href="#aff1">1</a></sup><sup><a href="#equal-contrib">#</a></sup>, <span property="dc:creator">Hsin-Chien Cheng</span><sup><a href="#aff1">1</a></sup><sup><a href="#equal-contrib">#</a></sup>, <span property="dc:creator">Daniel A. Barbash</span><sup><a href="#aff2">2</a></sup>, <span property="dc:creator">Hsiao-Pei Yang</span><sup><a href="#aff1">1</a></sup><sup>,</sup><sup><a href="#aff2">2</a></sup><sup><a href="#cor1" class="fnoteref">*</a></sup></p><p xmlns:xs="http://www.w3.org/2001/XMLSchema" xmlns:xlink="http://www.w3.org/1999/xlink" xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:aml="http://topazproject.org/aml/" class="affiliations" xpathLocation="noSelect"><a name="aff1" id="aff1"></a><strong>1</strong> Faculty of Life Sciences and Institute of Genome Sciences, National Yang-Ming University, Taipei, Taiwan, Republic of China, <a name="aff2" id="aff2"></a><strong>2</strong> Department of Molecular Biology and Genetics, Cornell University, Ithaca, New York, United States of America</p><div xmlns:xs="http://www.w3.org/2001/XMLSchema" xmlns:xlink="http://www.w3.org/1999/xlink" xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:aml="http://topazproject.org/aml/" class="abstract" xpathLocation="/article[1]/front[1]/article-meta[1]/abstract[1]"><a id="abstract0" name="abstract0" toc="abstract0" title="Abstract"></a><h2 xpathLocation="noSelect">Abstract <a href="#top">Top</a></h2><p xpathLocation="/article[1]/front[1]/article-meta[1]/abstract[1]/p[1]">We describe here the <i>Drosophila</i> gene <i>hydra</i> that appears to have originated de novo in the <i>melanogaster</i> subgroup and subsequently evolved in both structure and expression level in <span class="genus-species">Drosophila melanogaster</span> and its sibling species. <i>D. melanogaster hydra</i> encodes a predicted protein of ~300 amino acids with no apparent similarity to any previously known proteins. The syntenic region flanking <i>hydra</i> on both sides is found in both <span class="genus-species">D. ananassae</span> and <i>D. pseudoobscura,</i> but <i>hydra</i> is found only in <i>melanogaster</i> subgroup species, suggesting that it originated less than ~13 million y ago. Exon 1 of <i>hydra</i> has undergone recurrent duplications, leading to the formation of nine tandem alternative exon 1s in <i>D. melanogaster.</i> Seven of these alternative exons are flanked on their 3′ side by the transposon <i>DINE-1</i> (<i>Drosophila</i> interspersed element-1). We demonstrate that at least four of the nine duplicated exon 1s can function as alternative transcription start sites. The entire <i>hydra</i> locus has also duplicated in <span class="genus-species">D. simulans</span> and <span class="genus-species">D. sechellia</span>. <i>D. melanogaster hydra</i> is expressed most intensely in the proximal testis, suggesting a role in late-stage spermatogenesis. The coding region of <i>hydra</i> has a relatively high Ka/Ks ratio between species, but the ratio is less than 1 in all comparisons, suggesting that <i>hydra</i> is subject to functional constraint. Analysis of sequence polymorphism and divergence of <i>hydra</i> shows that it has evolved under positive selection in the lineage leading to <i>D. melanogaster.</i> The dramatic structural changes surrounding the first exons do not affect the tissue specificity of gene expression: <i>hydra</i> is expressed predominantly in the testes in <i>D. melanogaster, D. simulans,</i> and <i>D. yakuba.</i> However, we have found that expression level changed dramatically (~ >20-fold) between <span class="genus-species">D. melanogaster</span> and <i>D. simulans.</i> While <i>hydra</i> initially evolved in the absence of nearby transposable element insertions, we suggest that the subsequent accumulation of repetitive sequences in the <i>hydra</i> region may have contributed to structural and expression-level evolution by inducing rearrangements and causing local heterochromatinization. Our analysis further shows that recurrent evolution of both gene structure and expression level may be characteristics of newly evolved genes. We also suggest that late-stage spermatogenesis is the functional target for newly evolved and rapidly evolving male-specific genes.</p> </div><div xmlns:xs="http://www.w3.org/2001/XMLSchema" xmlns:xlink="http://www.w3.org/1999/xlink" xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:aml="http://topazproject.org/aml/" class="abstract" xpathLocation="/article[1]/front[1]/article-meta[1]/abstract[2]"><a id="abstract1" name="abstract1" toc="abstract1" title="Author Summary"></a> <h2 xpathLocation="noSelect">Author Summary <a href="#top">Top</a></h2> <p xpathLocation="/article[1]/front[1]/article-meta[1]/abstract[2]/sec[1]/p[1]">Similar groups of animals have similar numbers of genes, but not all of these genes are the same. While some genes are highly conserved and can be easily and uniquely identified in species ranging from yeast to plants to humans, other genes are sometimes found in only a small number or even in a single species. Such newly evolved genes may help produce traits that make species unique. We describe here a newly evolved gene called <i>hydra</i> that occurs only in a small subgroup of <i>Drosophila</i> species. <i>hydra</i> is expressed in the testes, suggesting that it may have a function in male fertility. <i>hydra</i> has evolved significantly in its structure and protein-coding sequence among species. The authors named the gene <i>hydra</i> after the nine-headed monster slain by Hercules because in one species, <i>Drosophila melanogaster, hydra</i> has nine potential alternative first exons. Perhaps because of this or other structural changes, the level of RNA made by <i>hydra</i> differs significantly between one pair of species. This analysis reveals that newly created genes may evolve rapidly in sequence, structure, and expression level.</p> </div> <div xmlns:xs="http://www.w3.org/2001/XMLSchema" xmlns:xlink="http://www.w3.org/1999/xlink" xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:aml="http://topazproject.org/aml/" class="articleinfo" xpathLocation="noSelect"><p><strong>Citation: </strong>Chen S-T, Cheng H-C, Barbash DA, Yang H-P (2007) Evolution of <i>hydra,</i> a Recently Evolved Testis-Expressed Gene with Nine Alternative First Exons in <span class="genus-species">Drosophila melanogaster</span>. PLoS Genet 3(7): e107. doi:10.1371/journal.pgen.0030107</p><p><strong>Editor: </strong>Harmit Singh Malik, Fred Hutchinson Cancer Research Center, United States of America</p><p></p><p><strong>Received:</strong> January 10, 2007; <strong>Accepted:</strong> May 15, 2007; <strong>Published:</strong> July 6, 2007</p><p><strong>Copyright:</strong> © 2007 Chen et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.</p><p><strong>Funding:</strong> This work was supported by a grant (NSC 93–2311-B-010–008) to HPY from National Sciences Council, Taiwan.</p><p><strong>Competing interests:</strong> The authors have declared that no competing interests exist.</p><p><strong>Abbreviations: </strong>CDS, coding sequence; <i>DINE-1</i>, <i>Drosophila</i> interspersed element-1; MK test, McDonald-Kreitman test; RACE, rapid amplification of cDNA ends; TE, transposable element; UTR, untranslated region</p><p><a name="cor1"></a>* To whom correspondence should be addressed. E-mail: <a href="mailto:hy31@cornell.edu">hy31@cornell.edu</a></p><p><a name="equal-contrib"></a># These authors contributed equally to this work. </p></div> <div xmlns:xs="http://www.w3.org/2001/XMLSchema" xmlns:xlink="http://www.w3.org/1999/xlink" xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:aml="http://topazproject.org/aml/" id="section1" xpathLocation="/article[1]/body[1]/sec[1]"><a id="s1" name="s1" toc="s1" title="Introduction"></a><h3 xpathLocation="noSelect">Introduction <a href="#top">Top</a></h3><p xpathLocation="/article[1]/body[1]/sec[1]/p[1]">Much of the genetic novelty that accompanies speciation and organismal evolution is driven by reutilization of pre-existing genetic information. In an influential essay, Francois Jacob likened evolution to a process of tinkering [<a href="#pgen-0030107-b001">1</a>]. After the primordial evolution of truly new macromolecules and mechanisms of replication, Jacob suggested that much of phenotypic novelty arises from reusing, recombining, and altering the function of available genes.</p> <p xpathLocation="/article[1]/body[1]/sec[1]/p[2]">This view of evolution is strongly supported by studies of new-gene evolution. The vast majority of newly evolved genes can be attributed to duplication of pre-existing genes. These duplication events can range from single-gene events to duplications of entire genomes [<a href="#pgen-0030107-b002">2</a>,<a href="#pgen-0030107-b003">3</a>]. Much of protein evolution also conforms to Jacob's view, as new proteins are often generated from shuffling pre-existing protein domains [<a href="#pgen-0030107-b004">4</a>].</p> <p xpathLocation="/article[1]/body[1]/sec[1]/p[3]">The tinkering view of evolution does not rule out the occasional generation of novel protein sequences. One question then is whether and by what mechanisms such novel proteins evolve. Presumably novel proteins derive from noncoding sequences that acquire appropriate transcriptional and translational regulatory sequences. Experimental evolution studies suggest that random sequences of proteins can acquire biological functions at frequencies that are, surprisingly, greater than miniscule [<a href="#pgen-0030107-b005">5</a>]. A recent study reported the exciting finding of several such candidate de novo genes in <i>Drosophila</i> that may be functional, based on RNA expression analysis [<a href="#pgen-0030107-b006">6</a>]. A large number of new exons have also been identified in rodents that appear to have derived from incorporation of intronic sequences into mRNAs [<a href="#pgen-0030107-b007">7</a>].</p> <p xpathLocation="/article[1]/body[1]/sec[1]/p[4]">A large fraction of eukaryotic genomes is composed of transposable elements (TEs). Because the TE component of genomes can evolve rapidly, TEs have a major impact on genome evolution [<a href="#pgen-0030107-b008">8</a>–<a href="#pgen-0030107-b010">10</a>]. TEs are widely considered to be selfish parasites that are deleterious to their host's fitness [<a href="#pgen-0030107-b011">11</a>], and most are likely eliminated quickly by natural selection. However, accumulating evidence has also shown that TEs can serve as an important source of genetic variation and genomic novelty [<a href="#pgen-0030107-b008">8</a>,<a href="#pgen-0030107-b012">12</a>–<a href="#pgen-0030107-b014">14</a>].</p> <p xpathLocation="/article[1]/body[1]/sec[1]/p[5]">TEs can generate genetic novelty by at least five different mechanisms. First, the reverse transcriptase enzyme from retrotransposons can generate duplicated retroposed genes [<a href="#pgen-0030107-b015">15</a>–<a href="#pgen-0030107-b017">17</a>] or generate chimeric fusion genes [<a href="#pgen-0030107-b015">15</a>,<a href="#pgen-0030107-b018">18</a>–<a href="#pgen-0030107-b021">21</a>]. Second, TEs can change expression patterns of adjacent genes by providing novel regulatory elements or by disrupting host gene regulatory functions [<a href="#pgen-0030107-b014">14</a>,<a href="#pgen-0030107-b022">22</a>–<a href="#pgen-0030107-b026">26</a>]. Third, coding regions from TEs such as envelope proteins and transposase enzymes can be incorporated by the host species to modify or even create new host protein-coding genes [<a href="#pgen-0030107-b013">13</a>,<a href="#pgen-0030107-b027">27</a>]. Fourth, TEs can contribute to noncoding regions (untranslated regions [UTRs]) of genes [<a href="#pgen-0030107-b012">12</a>,<a href="#pgen-0030107-b024">24</a>,<a href="#pgen-0030107-b028">28</a>–<a href="#pgen-0030107-b030">30</a>]. Fifth, TE insertions create multiple highly homologous sites throughout the genome that can cause duplications by ectopic recombination [<a href="#pgen-0030107-b009">9</a>,<a href="#pgen-0030107-b031">31</a>].</p> <p xpathLocation="/article[1]/body[1]/sec[1]/p[6]">Comparisons between genomes have proven to be a powerful way to identify new genes [<a href="#pgen-0030107-b032">32</a>] and to reconstruct the early history of new-gene evolution [<a href="#pgen-0030107-b002">2</a>]. This approach has provided new data for models and mechanisms leading to new-gene evolution [<a href="#pgen-0030107-b006">6</a>,<a href="#pgen-0030107-b020">20</a>,<a href="#pgen-0030107-b033">33</a>–<a href="#pgen-0030107-b035">35</a>].</p> <p xpathLocation="/article[1]/body[1]/sec[1]/p[7]">Such a comparative approach is used here to investigate the evolutionary history of a recently evolved gene in <i>Drosophila.</i> We report the characterization of the gene <i>hydra,</i> located in the pericentric region of the X chromosome in <i>D. melanogaster. hydra</i> was originally reported as predicted gene <i>CG1338</i> [<a href="#pgen-0030107-b036">36</a>]. We show that <i>hydra</i> originated in the <i>melanogaster</i> subgroup of <i>Drosophila</i> and subsequently experienced dramatic changes in its gene structure, including the formation of multiple alternative first exons, most of which are associated with the transposon <i>DINE-1</i> (<i>Drosophila</i> interspersed element-1)<i>.</i> We also investigate the history and impact of these gene-structure changes at both the DNA sequence and RNA expression levels by comparison among species of the <i>melanogaster</i> subgroup<i>.</i> We suggest that new genes will tend to evolve rapidly in coding sequence (CDS), gene structure, and gene-expression level. We also suggest that TE accumulation can cause local heterochromatinization that can in turn have a major impact on the evolution of gene structure and gene expression.</p> </div> <div xmlns:xs="http://www.w3.org/2001/XMLSchema" xmlns:xlink="http://www.w3.org/1999/xlink" xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:aml="http://topazproject.org/aml/" id="section2" xpathLocation="/article[1]/body[1]/sec[2]"><a id="s2" name="s2" toc="s2" title="Results"></a><h3 xpathLocation="noSelect">Results <a href="#top">Top</a></h3> <h4 xpathLocation="/article[1]/body[1]/sec[2]/sec[1]/title[1]">The <i>hydra</i> Gene Is Restricted to the <i>melanogaster</i> Subgroup</h4> <p xpathLocation="/article[1]/body[1]/sec[2]/sec[1]/p[1]"><i>CG1338</i> is located near the pericentric region of the X chromosome in <span class="genus-species">D. melanogaster</span> (cytological region 19E1). We first became interested in <i>CG1338</i> during a genome-wide analysis of the transposon <i>DINE-1</i> in the <span class="genus-species">D. melanogaster</span> genome. We present evidence below that <i>CG1338</i> contains nine duplicated first exons in <span class="genus-species">D. melanogaster</span>. Because of these nine duplicated exon 1s (see <a href="#pgen-0030107-g001">Figure 1</a>A), we propose to rename this gene <i>hydra,</i> after the nine-headed monster slain by Hercules.</p> <div class="figure" xpathLocation="/article[1]/body[1]/sec[2]/sec[1]/fig[1]"><a name="pgen-0030107-g001" id="pgen-0030107-g001" title="Click for larger image " href="/article/slideshow.action?uri=info:doi/10.1371/journal.pgen.0030107&imageURI=info:doi/10.1371/journal.pgen.0030107.g001" onclick="window.open(this.href,'plosSlideshow','directories=no,location=no,menubar=no,resizable=yes,status=no,scrollbars=yes,toolbar=no,height=600,width=850');return false;"><img xpathLocation="noSelect" border="1" src="/article/fetchObject.action?uri=info:doi/10.1371/journal.pgen.0030107.g001&representation=PNG_S" align="left" alt="thumbnail" class="thumbnail"></a><p><strong xpathLocation="/article[1]/body[1]/sec[2]/sec[1]/fig[1]/label[1]"><a href="/article/slideshow.action?uri=info:doi/10.1371/journal.pgen.0030107&imageURI=info:doi/10.1371/journal.pgen.0030107.g001" onclick="window.open(this.href,'plosSlideshow','directories=no,location=no,menubar=no,resizable=yes,status=no,scrollbars=yes,toolbar=no,height=600,width=850');return false;"><span xpathLocation="/article[1]/body[1]/sec[2]/sec[1]/fig[1]/label[1]">Figure 1. </span></a> <span xpathLocation="/article[1]/body[1]/sec[2]/sec[1]/fig[1]/caption[1]/title[1]">Evolution of <i>hydra</i> in <i>Drosophila</i> Species</span></strong></p><p xpathLocation="/article[1]/body[1]/sec[2]/sec[1]/fig[1]/caption[1]/p[1]">(A) The <i>hydra</i> region of the X-chromosome of <i>D. melanogaster,</i> based on FlyBase genome browser release 4.3. The <i>hydra</i> gene was previously annotated as producing two alternative transcripts, RA and RB, derived from alternative exon 1s. The proposed annotation of seven additional exon 1s is based on evidence presented here.</p> <p xpathLocation="/article[1]/body[1]/sec[2]/sec[1]/fig[1]/caption[1]/p[2]">(B) Evolution of <i>hydra</i> region and <i>hydra</i> gene structure in seven Drosophila species. <i>hydra</i> and the flanking gene <i>CG1835</i> are located in a recently expanded region between <i>run</i> and <i>cyp6v1. hydra</i> originated in the common ancestor of the <i>melanogaster</i> subgroup (arrow A). In <i>D. melanogaster,</i> this region between <i>run</i> and <i>cyp6v1</i> is ~32 kb (10 kb from the 3′ end of <i>hydra</i> to <i>cyp6v1</i> and 17 kb from the 5′ end of <i>hydra</i> to <i>run</i>), but is only ~26 kb apart in <span class="genus-species">D. ananassae</span> and <i>D. pseudoobscura,</i> where both <i>hydra</i> and <i>CG1835</i> are missing. <i>hydra</i> has gone through multiple cycles of duplication and rearrangement in <span class="genus-species">D. melanogaster</span> and its sibling species, and accumulated insertions of the transposon <i>DINE-1</i> and other repetitive sequences (arrow B). <i>CG1835</i> is on the opposite strand from all other genes, as indicated by its leftward-pointing arrow. Three copies of <i>hydra</i> are found on two unlinked scaffolds in <i>D. sechellia.</i> Note that the distances are not to scale.</p> <span xpathLocation="noSelect">doi:10.1371/journal.pgen.0030107.g001</span><div class="clearer"></div></div><p xpathLocation="/article[1]/body[1]/sec[2]/sec[1]/p[2]">We found that the gene region surrounding <i>hydra</i> in <span class="genus-species">D. melanogaster</span> contains dense repeats of <i>DINE-1</i> (<a href="#pgen-0030107-g001">Figure 1</a>A). <i>DINE-1,</i> also named <i>INE-1</i> or <i>DNAREP1_DM,</i> is a highly abundant transposon that is predominantly found in the heterochromatic regions of the <span class="genus-species">D. melanogaster</span> genome [<a href="#pgen-0030107-b037">37</a>,<a href="#pgen-0030107-b038">38</a>] and is believed to have invaded the <i>Drosophila</i> genome before the diversification of the <i>melanogaster</i> subgroup [<a href="#pgen-0030107-b037">37</a>–<a href="#pgen-0030107-b040">40</a>]. Further analysis showed that <i>hydra</i> is flanked by two blocks of tandem repeats, with duplicated fragments of <i>DINE-1</i> in the 5′ end and an undefined 500-bp repeat in the 3′ end. Using available genomic contigs from various <i>Drosophila</i> species (<a href="http://flybase.net/blast">http://flybase.net/blast</a>), we found that the ~7-kb region surrounding <i>hydra,</i> including the adjacent gene <i>CG1835,</i> only exists in species of the <i>melanogaster</i> subgroup, but not in other species outside of the subgroup. BLAST searches using unique sequences from <i>hydra</i> identified no similar sequences in other regions of these genomes. We suggest that <i>hydra</i> evolved recently in the species of the <i>melanogaster</i> subgroup (<a href="#pgen-0030107-g001">Figure 1</a>B). This conclusion was confirmed by Southern hybridization under low stringency using <i>hydra</i> exons 2–4 from <span class="genus-species">D. melanogaster</span> as the probe with DNA extracted from <i>D. melanogaster, D. simulans, D. yakuba, D. erecta, D. ananassae, D. pseudoobscura,</i> and <i>D. virilis.</i> Hybridization signals were only detected in flies of the <i>melanogaster</i> subgroup (i.e., <i>D. melanogaster, D. simulans, D. yakuba, D. erecta</i>), but not in the other species (unpublished data). TBLASTN searches to the nonredundant (nr) or whole-genome shotgun (wgs) databases found no hits to non-<i>melanogaster</i> subgroup <i>Drosophila</i> species with E values < 0.001.</p> <h4 xpathLocation="/article[1]/body[1]/sec[2]/sec[2]/title[1]">Evolution of the Gene Structure of <i>hydra</i></h4> <p xpathLocation="/article[1]/body[1]/sec[2]/sec[2]/p[1]">According to the Flybase genome annotation (<a href="http://www.flybase.org">http://www.flybase.org</a>), <i>hydra</i> of <span class="genus-species">D. melanogaster</span> contains four exons, and two types of transcripts (type A and type B), which are transcribed using alternative first exons. Our analysis of the <i>hydra</i> gene region suggested that there are seven additional putative first exons similar to the two annotated first exons located in a region of dense <i>DINE-1s</i> in <span class="genus-species">D. melanogaster</span> (<a href="#pgen-0030107-g001">Figure 1</a>A; <a href="#pgen-0030107-se001">Text S1</a>). These seven additional potential first exons share similarity with the two annotated exon 1s in their CDSs (which are nine codons long) and in their 5′ upstream regions. The first of these duplicated exons may be nonfunctional because it creates a stop codon when spliced to exon 2, assuming that it has the same structure and splicing pattern as the other 8 exons. Alternatively, this first exon 1 may use a different 3′ splice site, although no such evidence was found in our 5′ rapid amplification of cDNA ends (RACE) analysis described below (<a href="#pgen-0030107-t001">Table 1</a>).</p> <div class="figure" xpathLocation="/article[1]/body[1]/sec[2]/sec[2]/table-wrap[1]"><a name="pgen-0030107-t001" id="pgen-0030107-t001" title="Click for larger image " href="/article/slideshow.action?uri=info:doi/10.1371/journal.pgen.0030107&imageURI=info:doi/10.1371/journal.pgen.0030107.t001" onclick="window.open(this.href,'plosSlideshow','directories=no,location=no,menubar=no,resizable=yes,status=no,scrollbars=yes,toolbar=no,height=600,width=850');return false;"><img xpathLocation="noSelect" border="1" src="/article/fetchObject.action?uri=info:doi/10.1371/journal.pgen.0030107.t001&representation=PNG_S" align="left" alt="thumbnail" class="thumbnail"></a><p><strong xpathLocation="/article[1]/body[1]/sec[2]/sec[2]/table-wrap[1]/label[1]"><a href="/article/slideshow.action?uri=info:doi/10.1371/journal.pgen.0030107&imageURI=info:doi/10.1371/journal.pgen.0030107.t001" onclick="window.open(this.href,'plosSlideshow','directories=no,location=no,menubar=no,resizable=yes,status=no,scrollbars=yes,toolbar=no,height=600,width=850');return false;"><span xpathLocation="/article[1]/body[1]/sec[2]/sec[2]/table-wrap[1]/label[1]">Table 1. </span></a></strong></p><p xpathLocation="/article[1]/body[1]/sec[2]/sec[2]/table-wrap[1]/caption[1]/p[1]">Relative Usage of Different Exon 1s of <i>hydra,</i> Determined by 5′ RACE</p> <span xpathLocation="noSelect">doi:10.1371/journal.pgen.0030107.t001</span><div class="clearer"></div></div><p xpathLocation="/article[1]/body[1]/sec[2]/sec[2]/p[2]">Our further analysis of multiple lines of <span class="genus-species">D. melanogaster</span> (and <span class="genus-species">D. simulans</span>) with Southern hybridization detected substantial length variation in the gene region, presumably due to length variation in the exon 1 region (<a href="#pgen-0030107-g002">Figure 2</a>). Although we have not determined the sequence structure of these alleles, the length variation observed is consistent with the hypothesis that the number of alternative first exons varies in <i>D. melanogaster.</i> In contrast, there is only a single exon 1 in the orthologous region of <i>hydra</i> from the species <span class="genus-species">D. yakuba</span> and <span class="genus-species">D. erecta</span> (<a href="#pgen-0030107-se005">Texts S5</a> and <a href="#pgen-0030107-se006">S6</a>), and there is no length polymorphism in this region in <span class="genus-species">D. yakuba</span> (unpublished data). This suggests that the dramatic gene structure change by duplication of exon 1 in <i>hydra</i> occurred within ~5–13 million y, after the divergence of <span class="genus-species">D. melanogaster</span> and <span class="genus-species">D. yakuba</span> [<a href="#pgen-0030107-b041">41</a>,<a href="#pgen-0030107-b042">42</a>].</p> <div class="figure" xpathLocation="/article[1]/body[1]/sec[2]/sec[2]/fig[1]"><a name="pgen-0030107-g002" id="pgen-0030107-g002" title="Click for larger image " href="/article/slideshow.action?uri=info:doi/10.1371/journal.pgen.0030107&imageURI=info:doi/10.1371/journal.pgen.0030107.g002" onclick="window.open(this.href,'plosSlideshow','directories=no,location=no,menubar=no,resizable=yes,status=no,scrollbars=yes,toolbar=no,height=600,width=850');return false;"><img xpathLocation="noSelect" border="1" src="/article/fetchObject.action?uri=info:doi/10.1371/journal.pgen.0030107.g002&representation=PNG_S" align="left" alt="thumbnail" class="thumbnail"></a><p><strong xpathLocation="/article[1]/body[1]/sec[2]/sec[2]/fig[1]/label[1]"><a href="/article/slideshow.action?uri=info:doi/10.1371/journal.pgen.0030107&imageURI=info:doi/10.1371/journal.pgen.0030107.g002" onclick="window.open(this.href,'plosSlideshow','directories=no,location=no,menubar=no,resizable=yes,status=no,scrollbars=yes,toolbar=no,height=600,width=850');return false;"><span xpathLocation="/article[1]/body[1]/sec[2]/sec[2]/fig[1]/label[1]">Figure 2. </span></a> <span xpathLocation="/article[1]/body[1]/sec[2]/sec[2]/fig[1]/caption[1]/title[1]">Length Variation of the Exon 1 Region of <i>hydra</i> in <span class="genus-species">D. melanogaster</span></span></strong></p><p xpathLocation="/article[1]/body[1]/sec[2]/sec[2]/fig[1]/caption[1]/p[1]">(A) Location of the probes (thick black lines) and restriction enzyme SacII cutting sites in <i>hydra</i> of <span class="genus-species">D. melanogaster</span> (top) and <i>D. simulans</i> (bottom)<i>.</i> Note that the region homologous to the probe is duplicated in <i>D. simulans.</i></p> <p xpathLocation="/article[1]/body[1]/sec[2]/sec[2]/fig[1]/caption[1]/p[2]">(B–C) Southern hybridization of genomic DNA extracted from multiple lines of <span class="genus-species">D. melanogaster</span> (B) and <i>D. simulans</i> (C)<i>. D. melanogaster</i> lines are all from Zimbabwe, Africa. <span class="genus-species">D. simulans</span> lines 1–4 are from California, United States; lines 5–7 are from Zimbabwe, Africa; and lines 8–14 are from Madagascar, Africa.</p> <span xpathLocation="noSelect">doi:10.1371/journal.pgen.0030107.g002</span><div class="clearer"></div></div><p xpathLocation="/article[1]/body[1]/sec[2]/sec[2]/p[3]">By comparing the orthologous sequences of <i>hydra</i> using the released assembled genomic sequences of <span class="genus-species">D. simulans</span> and <i>D. sechellia,</i> we found that this region has undergone local duplications in both species (<a href="#pgen-0030107-g001">Figure 1</a>B; <a href="#pgen-0030107-se002">Texts S2</a>–<a href="#pgen-0030107-se004">S4</a>). Determining the precise structure of the <i>hydra</i> region in <span class="genus-species">D. sechellia</span> will require further sequence analysis due to low sequence coverage of this region. We have, however, confirmed by Southern analysis that <span class="genus-species">D. simulans</span> does have two copies of <i>hydra</i> (<a href="#pgen-0030107-g002">Figure 2</a>C). In <i>D. simulans,</i> we find that one of these copies has two potential exon 1s. In <i>D. sechellia,</i> we identified two unlinked contigs containing <i>hydra</i>-homologous sequences (<a href="#pgen-0030107-g001">Figure 1</a>B). Scaffold 8 contains the syntenic genes <i>run</i> and <i>cyp6v1</i> flanking a single copy of <i>hydra.</i> This copy of <i>hydra</i> contains two putative exon 1s. Scaffold 600 contains two tandem copies of <i>hydra,</i> each of which contains two or three putative exon 1s. These data suggest the possibility that <span class="genus-species">D. sechellia</span> has three copies of <i>hydra,</i> although further analysis will be required to determine the relative locations of these apparent duplicated copies that are on different scaffolds. Despite this uncertainty, we were able to investigate the phylogenetic relationship of these copies of <i>hydra.</i> Using either the sequence between exons 2–4, inclusive (<a href="#pgen-0030107-g003">Figure 3</a>A; <a href="#pgen-0030107-se007">Text S7</a>) or of intron 1 (unpublished data), we obtained similar phylogenetic trees that suggest that <i>hydra</i> duplicated independently in <span class="genus-species">D. simulans</span> and <i>D. sechellia.</i> Because both gene regions produce the same phylogeny and these sequences span over 1,300 bp in all species, we consider it unlikely that this phylogenetic signal of independent duplications could be due to gene conversion.</p> <div class="figure" xpathLocation="/article[1]/body[1]/sec[2]/sec[2]/fig[2]"><a name="pgen-0030107-g003" id="pgen-0030107-g003" title="Click for larger image " href="/article/slideshow.action?uri=info:doi/10.1371/journal.pgen.0030107&imageURI=info:doi/10.1371/journal.pgen.0030107.g003" onclick="window.open(this.href,'plosSlideshow','directories=no,location=no,menubar=no,resizable=yes,status=no,scrollbars=yes,toolbar=no,height=600,width=850');return false;"><img xpathLocation="noSelect" border="1" src="/article/fetchObject.action?uri=info:doi/10.1371/journal.pgen.0030107.g003&representation=PNG_S" align="left" alt="thumbnail" class="thumbnail"></a><p><strong xpathLocation="/article[1]/body[1]/sec[2]/sec[2]/fig[2]/label[1]"><a href="/article/slideshow.action?uri=info:doi/10.1371/journal.pgen.0030107&imageURI=info:doi/10.1371/journal.pgen.0030107.g003" onclick="window.open(this.href,'plosSlideshow','directories=no,location=no,menubar=no,resizable=yes,status=no,scrollbars=yes,toolbar=no,height=600,width=850');return false;"><span xpathLocation="/article[1]/body[1]/sec[2]/sec[2]/fig[2]/label[1]">Figure 3. </span></a> <span xpathLocation="/article[1]/body[1]/sec[2]/sec[2]/fig[2]/caption[1]/title[1]">Phylogenetic Trees of <i>hydra</i></span></strong></p><p xpathLocation="/article[1]/body[1]/sec[2]/sec[2]/fig[2]/caption[1]/p[1]">Trees are based on (A) exon 2–4 sequences and (B) exon 1, including putative 5′ UTR sequences. The trees were built using the neighbor-joining method according to the Jukes-Cantor substitution model. Branch lengths are proportional to the number of nucleotide substitutions. Percentage bootstrap values are shown at each node (500 replicates). In (B), sequences mel 1–9 correspond to the alternative exon 1s of <span class="genus-species">D. melanogaster</span> shown in <a href="#pgen-0030107-g001">Figure 1</a>B. Sequences Ra and Rb are from the annotated transcripts of <i>D. melanogaster hydra</i> in FlyBase. <span class="genus-species">D. simulans</span> and <i>D. sechellia</i> exon 1s are labeled as shown in <a href="#pgen-0030107-g001">Figure 1</a>B. Note that mel 6 is part of group B but clusters with group A, presumably because of having a divergent 5′ UTR.</p> <span xpathLocation="noSelect">doi:10.1371/journal.pgen.0030107.g003</span><div class="clearer"></div></div><p xpathLocation="/article[1]/body[1]/sec[2]/sec[2]/p[4]">Upon further investigation of the intronic sequences next to exon 1, we found that seven out of the nine duplicated exon 1s in <span class="genus-species">D. melanogaster</span> and several of the duplicated exon 1s in both <span class="genus-species">D. simulans</span> and <span class="genus-species">D. sechellia</span> are immediately followed by <i>DINE-1</i> sequences, while in other species of the <i>melanogaster</i> subgroup, including <span class="genus-species">D. yakuba</span> and <i>D. erecta,</i> there are no <i>DINE-1s</i> in this region. We thought it likely for two reasons that insertion of <i>DINE-1</i> adjacent to <i>hydra</i> exon 1 occurred in the common ancestor of <i>D. melanogaster, D. simulans,</i> and <i>D. sechellia.</i> First, it seems highly unlikely that a TE would insert independently at the same location in different species. Second, <i>DINE-1</i> is thought to have been active and then to have become transpositionally inactive before these species diverged [<a href="#pgen-0030107-b038">38</a>,<a href="#pgen-0030107-b040">40</a>].</p> <p xpathLocation="/article[1]/body[1]/sec[2]/sec[2]/p[5]">To test this hypothesis and to understand the evolutionary history and mechanism that resulted in the exon 1 duplications of <i>hydra,</i> we performed phylogenetic analysis of all the available exon 1s (<a href="#pgen-0030107-g003">Figure 3</a>B; <a href="#pgen-0030107-se008">Text S8</a>). We found that <span class="genus-species">D. simulans</span> S2 and <span class="genus-species">D. sechellia</span> C3 are outgroups to all other exon 1s. Both of these exons are flanked by <i>DINE-1</i> sequence, which is consistent with our above suggestion that <i>DINE-1</i> insertion in this region is ancestral (at time B in <a href="#pgen-0030107-g001">Figure 1</a>B). If this inference of the ancestral state of exon 1 in these three species is correct, it is interesting to note that <i>DINE-1</i> does not flank every exon 1. Our data would then suggest that either <i>DINE-1</i> was lost next to some duplicated exon 1s or that some exon 1s duplicated without duplicating the adjacent <i>DINE-1.</i></p> <p xpathLocation="/article[1]/body[1]/sec[2]/sec[2]/p[6]">The relationships among the remaining <span class="genus-species">D. simulans</span> and <span class="genus-species">D. sechellia</span> exon 1s suggest that exon 1 duplicated before the speciation of <span class="genus-species">D. simulans</span> and <span class="genus-species">D. sechellia</span> to generate the exon 1 groups S1/S3 and C1/C4/C6, with another duplication event generating exon 1 group C2/C5/C7 (<a href="#pgen-0030107-g003">Figure 3</a>B). Both this tree and the one made using the rest of the locus (<a href="#pgen-0030107-g003">Figure 3</a>A) suggest that after these exon 1 duplications, the entire locus duplicated independently in <span class="genus-species">D. simulans</span> and <i>D. sechellia.</i></p> <p xpathLocation="/article[1]/body[1]/sec[2]/sec[2]/p[7]"><a href="#pgen-0030107-g003">Figure 3</a>B also suggests that exon 1 duplicated independently in <i>D. melanogaster.</i> Based on the sequence similarity of predicted exon 1 sequences, the duplicated first exons of <span class="genus-species">D. melanogaster</span> can be divided into three groups: group A, containing the first, second, third, and fifth duplicated exon 1s; group B, containing the fourth, seventh, eighth, and ninth duplicated exon 1s; and group C, containing the sixth duplicated exon 1. The first and the ninth exon 1s are the previously annotated exon 1s for transcript types RA and RB, respectively. Our phylogenetic analysis showed that exon 1s adjacent to each other are generally more closely related (<a href="#pgen-0030107-g003">Figure 3</a>B). These results suggest that both the exon 1s and their flanking <i>DINE-1</i>s were duplicated together, and that unequal crossing-over is the major mechanism generating the tandemly duplicated exons.</p> <h4 xpathLocation="/article[1]/body[1]/sec[2]/sec[3]/title[1]"><i>hydra</i> Is Expressed Predominantly in Adult Testes</h4> <p xpathLocation="/article[1]/body[1]/sec[2]/sec[3]/p[1]">RT-PCR analysis demonstrated that <i>hydra</i> is expressed in adult male testes in all three species tested: <i>D. melanogaster, D. simulans,</i> and <span class="genus-species">D. yakuba</span> (<a href="#pgen-0030107-g004">Figure 4</a>). This result demonstrates that the expression pattern of <i>hydra</i> is conserved despite having a very different gene structure in these species. In one out of two stocks of <span class="genus-species">D. melanogaster</span> that we examined, we also detected a low level of expression in the male carcass from which testes were removed (<a href="#pgen-0030107-g004">Figure 4</a>B). This expression pattern is consistent with <span class="genus-species">D. melanogaster</span> EST data: among ten ESTs in GenBank that match <i>hydra</i>, nine are from testis cDNA libraries, and one is from a larval fat-body library. We further investigated the pattern of expression of <i>hydra</i> in <span class="genus-species">D. melanogaster</span> by in situ hybridization. We found that <i>hydra</i> is expressed most intensely in the proximal region of the testis (<a href="#pgen-0030107-g005">Figure 5</a>), where mature sperm are formed, suggesting that <i>hydra</i> functions in late stages of sperm development.</p> <div class="figure" xpathLocation="/article[1]/body[1]/sec[2]/sec[3]/fig[1]"><a name="pgen-0030107-g004" id="pgen-0030107-g004" title="Click for larger image " href="/article/slideshow.action?uri=info:doi/10.1371/journal.pgen.0030107&imageURI=info:doi/10.1371/journal.pgen.0030107.g004" onclick="window.open(this.href,'plosSlideshow','directories=no,location=no,menubar=no,resizable=yes,status=no,scrollbars=yes,toolbar=no,height=600,width=850');return false;"><img xpathLocation="noSelect" border="1" src="/article/fetchObject.action?uri=info:doi/10.1371/journal.pgen.0030107.g004&representation=PNG_S" align="left" alt="thumbnail" class="thumbnail"></a><p><strong xpathLocation="/article[1]/body[1]/sec[2]/sec[3]/fig[1]/label[1]"><a href="/article/slideshow.action?uri=info:doi/10.1371/journal.pgen.0030107&imageURI=info:doi/10.1371/journal.pgen.0030107.g004" onclick="window.open(this.href,'plosSlideshow','directories=no,location=no,menubar=no,resizable=yes,status=no,scrollbars=yes,toolbar=no,height=600,width=850');return false;"><span xpathLocation="/article[1]/body[1]/sec[2]/sec[3]/fig[1]/label[1]">Figure 4. </span></a> <span xpathLocation="/article[1]/body[1]/sec[2]/sec[3]/fig[1]/caption[1]/title[1]">Expression of <i>hydra</i> detected by RT-PCR</span></strong></p><p xpathLocation="/article[1]/body[1]/sec[2]/sec[3]/fig[1]/caption[1]/p[1]">(A) <i>D. melanogaster, D. simulans,</i> and <i>D. yakuba.</i></p> <p xpathLocation="/article[1]/body[1]/sec[2]/sec[3]/fig[1]/caption[1]/p[2]">(B) Canton S line of <i>D. melanogaster.</i></p> <p xpathLocation="/article[1]/body[1]/sec[2]/sec[3]/fig[1]/caption[1]/p[3]">M, DNA kb size marker; G, genomic DNA; T, adult testis RNA; O, RNA from whole body of males with testis removed; +, positive control for cDNA O using primers for the gene <i>GAPDH</i>; −, negative PCR control. RNA was extracted from strain ORC of <span class="genus-species">D. melanogaster</span> (A), California strain w54 of <i>D. simulans,</i> and Tai18E2 of <span class="genus-species">D. yakuba</span>. Note that expression of <i>hydra</i> in <span class="genus-species">D. melanogaster</span> is specific to testis in the ORC strain (A), but slight expression was detected in other tissues in the Canton S strain (B).</p> <span xpathLocation="noSelect">doi:10.1371/journal.pgen.0030107.g004</span><div class="clearer"></div></div><div class="figure" xpathLocation="/article[1]/body[1]/sec[2]/sec[3]/fig[2]"><a name="pgen-0030107-g005" id="pgen-0030107-g005" title="Click for larger image " href="/article/slideshow.action?uri=info:doi/10.1371/journal.pgen.0030107&imageURI=info:doi/10.1371/journal.pgen.0030107.g005" onclick="window.open(this.href,'plosSlideshow','directories=no,location=no,menubar=no,resizable=yes,status=no,scrollbars=yes,toolbar=no,height=600,width=850');return false;"><img xpathLocation="noSelect" border="1" src="/article/fetchObject.action?uri=info:doi/10.1371/journal.pgen.0030107.g005&representation=PNG_S" align="left" alt="thumbnail" class="thumbnail"></a><p><strong xpathLocation="/article[1]/body[1]/sec[2]/sec[3]/fig[2]/label[1]"><a href="/article/slideshow.action?uri=info:doi/10.1371/journal.pgen.0030107&imageURI=info:doi/10.1371/journal.pgen.0030107.g005" onclick="window.open(this.href,'plosSlideshow','directories=no,location=no,menubar=no,resizable=yes,status=no,scrollbars=yes,toolbar=no,height=600,width=850');return false;"><span xpathLocation="/article[1]/body[1]/sec[2]/sec[3]/fig[2]/label[1]">Figure 5. </span></a> <span xpathLocation="/article[1]/body[1]/sec[2]/sec[3]/fig[2]/caption[1]/title[1]">In Situ Hybridization of DIG-Labeled Antisense RNA (A) and Sense Control RNA (B) of <i>hydra</i> to Testes of <span class="genus-species">D. melanogaster</span></span></strong></p><p xpathLocation="/article[1]/body[1]/sec[2]/sec[3]/fig[2]/caption[1]/p[1]">Expression is strongest in the proximal region of testes. ag, accessory glands; ed, ejaculatory duct.</p> <span xpathLocation="noSelect">doi:10.1371/journal.pgen.0030107.g005</span><div class="clearer"></div></div> <h4 xpathLocation="/article[1]/body[1]/sec[2]/sec[4]/title[1]">Functional Consequences of the Evolving Gene Structure of <i>hydra</i></h4> <p xpathLocation="/article[1]/body[1]/sec[2]/sec[4]/p[1]">To study the impact of exon 1 duplication on gene expression, we asked if each of the duplicated exons could function as a transcriptional start site. To determine whether each putative exon 1 is functional in <i>D. melanogaster,</i> we needed to use a technique that could distinguish these very similar potential transcripts. We therefore performed 5′ RACE analysis using RNA extracted from adult male testes of <span class="genus-species">D. melanogaster</span> and analyzed the sequences of 58 clones. The previously described Ra and Rb transcripts differ by three nucleotides at positions −21 to −23 in their 5′ UTRs as well as by a nonsynonymous polymorphism in their second codon. We designate alternative first exons 1, 2, 3, and 5 as class A (similar to Ra), and alternative first exons 4, 6, 7, 8, and 9 as class B (similar to Rb).</p> <p xpathLocation="/article[1]/body[1]/sec[2]/sec[4]/p[2]">Some of these sequences can be further distinguished by additional polymorphisms further 5′ in the 5′ UTRs. Six different groups of alternative transcripts could be potentially distinguished, with two of these groups containing two or three identical first exons (<a href="#pgen-0030107-t001">Table 1</a>). Among our 58 5′ RACE clones, four out of six of these groups were represented at least twice, demonstrating that at least four different alternative first exons in <i>hydra</i> are functional.</p> <p xpathLocation="/article[1]/body[1]/sec[2]/sec[4]/p[3]">We also analyzed to see if each duplicated first exon contains core promoter sequences known to be important for the initiation of transcription of <i>Drosophila</i> genes [<a href="#pgen-0030107-b043">43</a>]. We looked specifically for the TFIIB recognition element (−37 to −32 bp, GGGCGCC or CCACGCC), TATA box (−31to −26 bp; TATAAA); initiator (−1 to +4 bp; TCA(G/T)T(T/C)), and downstream promoter element (+28 to +32 bp; (A/G)G(A/T)(G/T)(G/A/C)). We found that almost all duplicated exon 1s contain all four core promoter sequences, with two exceptions: the sixth and the ninth duplicated exon 1s do not contain the downstream promoter element and the TATA box, respectively. Since both of these exons are used (<a href="#pgen-0030107-t001">Table 1</a>), our results suggest that these two elements are not essential for transcription of <i>hydra.</i></p> <p xpathLocation="/article[1]/body[1]/sec[2]/sec[4]/p[4]">Using the sequences of the clones from 5′ RACE, we also mapped the sites for transcription initiation. We found that most transcripts of <i>hydra</i> do not use a fixed site for transcription initiation. Instead, “slippery promoters” were found to be used in different exon 1s, as described for other <i>Drosophila</i> genes by Yasuhara et al. [<a href="#pgen-0030107-b044">44</a>].</p> <p xpathLocation="/article[1]/body[1]/sec[2]/sec[4]/p[5]">We also tested whether <i>hydra</i> structural evolution might lead to expression-level differences between sibling species by quantifying <i>hydra</i> expression levels in five wild lines of <span class="genus-species">D. melanogaster</span> and in four wild lines of <span class="genus-species">D. simulans</span> (<a href="#pgen-0030107-g006">Figure 6</a>). Strikingly, <i>hydra</i> was expressed at a substantially higher level in all <span class="genus-species">D. simulans</span> lines compared with all <span class="genus-species">D. melanogaster</span> lines. Among all pair-wise comparisons, the fold increase in <span class="genus-species">D. simulans</span> ranged from ~4 to ~150, with the mean fold difference being ~22. These data indicate that <i>hydra</i> has lower expression in <i>D. melanogaster,</i> despite having multiple alternative transcription start sites.</p> <div class="figure" xpathLocation="/article[1]/body[1]/sec[2]/sec[4]/fig[1]"><a name="pgen-0030107-g006" id="pgen-0030107-g006" title="Click for larger image " href="/article/slideshow.action?uri=info:doi/10.1371/journal.pgen.0030107&imageURI=info:doi/10.1371/journal.pgen.0030107.g006" onclick="window.open(this.href,'plosSlideshow','directories=no,location=no,menubar=no,resizable=yes,status=no,scrollbars=yes,toolbar=no,height=600,width=850');return false;"><img xpathLocation="noSelect" border="1" src="/article/fetchObject.action?uri=info:doi/10.1371/journal.pgen.0030107.g006&representation=PNG_S" align="left" alt="thumbnail" class="thumbnail"></a><p><strong xpathLocation="/article[1]/body[1]/sec[2]/sec[4]/fig[1]/label[1]"><a href="/article/slideshow.action?uri=info:doi/10.1371/journal.pgen.0030107&imageURI=info:doi/10.1371/journal.pgen.0030107.g006" onclick="window.open(this.href,'plosSlideshow','directories=no,location=no,menubar=no,resizable=yes,status=no,scrollbars=yes,toolbar=no,height=600,width=850');return false;"><span xpathLocation="/article[1]/body[1]/sec[2]/sec[4]/fig[1]/label[1]">Figure 6. </span></a> <span xpathLocation="/article[1]/body[1]/sec[2]/sec[4]/fig[1]/caption[1]/title[1]">Relative Abundance of <i>hydra</i> mRNA Quantified by Real-Time RT-PCR in Various Lines of <span class="genus-species">D. melanogaster</span> and <span class="genus-species">D. simulans</span></span></strong></p><p xpathLocation="/article[1]/body[1]/sec[2]/sec[4]/fig[1]/caption[1]/p[1]">For each line, the abundance of <i>hydra</i> relative to <i>GAPDH</i> was determined. This value was then compared for each line relative to <span class="genus-species">D. melanogaster</span> Canton S (mel_CS), which is normalized here to a value of 1. </p> <span xpathLocation="noSelect">doi:10.1371/journal.pgen.0030107.g006</span><div class="clearer"></div></div> <h4 xpathLocation="/article[1]/body[1]/sec[2]/sec[5]/title[1]">Nonneutral Evolution of <i>hydra</i></h4> <p xpathLocation="/article[1]/body[1]/sec[2]/sec[5]/p[1]"><i>hydra</i> contains an intact reading frame in all <i>melanogaster</i> subgroup species, encoding a predicted protein of 302, 280, and 308 amino acids in <i>D. melanogaster, D. simulans,</i> and <i>D. yakuba,</i> respectively. We calculated Ka/Ks ratios of the coding region of <i>hydra</i> among species in the <i>melanogaster</i> subgroup (<a href="#pgen-0030107-t002">Table 2</a>). The ratio is <1 in all comparisons, suggesting that <i>hydra</i> is evolving under some degree of functional constraint.</p> <div class="figure" xpathLocation="/article[1]/body[1]/sec[2]/sec[5]/table-wrap[1]"><a name="pgen-0030107-t002" id="pgen-0030107-t002" title="Click for larger image " href="/article/slideshow.action?uri=info:doi/10.1371/journal.pgen.0030107&imageURI=info:doi/10.1371/journal.pgen.0030107.t002" onclick="window.open(this.href,'plosSlideshow','directories=no,location=no,menubar=no,resizable=yes,status=no,scrollbars=yes,toolbar=no,height=600,width=850');return false;"><img xpathLocation="noSelect" border="1" src="/article/fetchObject.action?uri=info:doi/10.1371/journal.pgen.0030107.t002&representation=PNG_S" align="left" alt="thumbnail" class="thumbnail"></a><p><strong xpathLocation="/article[1]/body[1]/sec[2]/sec[5]/table-wrap[1]/label[1]"><a href="/article/slideshow.action?uri=info:doi/10.1371/journal.pgen.0030107&imageURI=info:doi/10.1371/journal.pgen.0030107.t002" onclick="window.open(this.href,'plosSlideshow','directories=no,location=no,menubar=no,resizable=yes,status=no,scrollbars=yes,toolbar=no,height=600,width=850');return false;"><span xpathLocation="/article[1]/body[1]/sec[2]/sec[5]/table-wrap[1]/label[1]">Table 2. </span></a></strong></p><p xpathLocation="/article[1]/body[1]/sec[2]/sec[5]/table-wrap[1]/caption[1]/p[1]">Summary of Ka and Ks Analysis of <i>hydra</i> among Four Species of the <i>melanogaster</i> Subgroup</p> <span xpathLocation="noSelect">doi:10.1371/journal.pgen.0030107.t002</span><div class="clearer"></div></div><p xpathLocation="/article[1]/body[1]/sec[2]/sec[5]/p[2]">To gain further insight into the evolution of <i>hydra,</i> we collected population samples from <i>D. melanogaster</i> and <i>D. simulans,</i> which have the highest interspecific Ka/Ks ratio of 0.75 (<a href="#pgen-0030107-se009">Texts S9</a> and <a href="#pgen-0030107-se010">S10</a>). We found that the nucleotide diversity at both synonymous (πs) and nonsynonymous (πa) sites in <span class="genus-species">D. melanogaster</span> is similar to the average of other functional genes, with about ten times more polymorphism at synonymous sites relative to nonsynonymous sites (<a href="#pgen-0030107-t003">Table 3</a>). In contrast, there is not much difference between πs and πa in <i>D. simulans,</i> where πs is much lower than the average of other genes for this species [<a href="#pgen-0030107-b045">45</a>]. In order to further investigate whether this unusual pattern of nucleotide diversity (similar levels of synonymous and nonsynonymous polymorphism) in <span class="genus-species">D. simulans</span> is lineage specific, we studied polymorphism in <i>D. yakuba.</i> πs and πa of <i>hydra</i> in <span class="genus-species">D. yakuba</span> are similar to those of <i>D. melanogaster,</i> and πs is similar to the average value (0.0127) of six X-linked loci in <span class="genus-species">D. yakuba</span> [<a href="#pgen-0030107-b046">46</a>], suggesting that the unusual pattern of nucleotide diversity of <i>hydra</i> is restricted only to <i>D. simulans.</i> The approximately equal values of πs and πa in <span class="genus-species">D. simulans</span> may suggest that <i>hydra</i> is under reduced functional constraint in <i>D. simulans.</i> Two findings suggest, however, that <i>hydra</i> is not a pseudogene in <i>D. simulans.</i> First, it has an intact open reading frame, and second, <i>hydra</i> is expressed in <span class="genus-species">D. simulans</span> and has a similar expression pattern to other species (see above).</p> <div class="figure" xpathLocation="/article[1]/body[1]/sec[2]/sec[5]/table-wrap[2]"><a name="pgen-0030107-t003" id="pgen-0030107-t003" title="Click for larger image " href="/article/slideshow.action?uri=info:doi/10.1371/journal.pgen.0030107&imageURI=info:doi/10.1371/journal.pgen.0030107.t003" onclick="window.open(this.href,'plosSlideshow','directories=no,location=no,menubar=no,resizable=yes,status=no,scrollbars=yes,toolbar=no,height=600,width=850');return false;"><img xpathLocation="noSelect" border="1" src="/article/fetchObject.action?uri=info:doi/10.1371/journal.pgen.0030107.t003&representation=PNG_S" align="left" alt="thumbnail" class="thumbnail"></a><p><strong xpathLocation="/article[1]/body[1]/sec[2]/sec[5]/table-wrap[2]/label[1]"><a href="/article/slideshow.action?uri=info:doi/10.1371/journal.pgen.0030107&imageURI=info:doi/10.1371/journal.pgen.0030107.t003" onclick="window.open(this.href,'plosSlideshow','directories=no,location=no,menubar=no,resizable=yes,status=no,scrollbars=yes,toolbar=no,height=600,width=850');return false;"><span xpathLocation="/article[1]/body[1]/sec[2]/sec[5]/table-wrap[2]/label[1]">Table 3. </span></a></strong></p><p xpathLocation="/article[1]/body[1]/sec[2]/sec[5]/table-wrap[2]/caption[1]/p[1]">Summary of Polymorphism Data from <i>hydra</i> in <span class="genus-species">D. melanogaster</span>, <i>D. simulans,</i> and <span class="genus-species">D. yakuba</span></p> <span xpathLocation="noSelect">doi:10.1371/journal.pgen.0030107.t003</span><div class="clearer"></div></div><p xpathLocation="/article[1]/body[1]/sec[2]/sec[5]/p[3]">Results of the McDonald-Kreitman (MK) test [<a href="#pgen-0030107-b047">47</a>] among these three species are shown in <a href="#pgen-0030107-t004">Table 4</a>. Neutral evolution of <i>hydra</i> can be rejected between <span class="genus-species">D. melanogaster</span> and <i>D. yakuba,</i> which we suggest is caused by the large number of nonsynonymous substitutions between these species. There is also a large amount of nonsynonymous divergence between <span class="genus-species">D. melanogaster</span> and <i>D. simulans.</i> We do not, however, reject neutrality in this case, likely due to the unusually low πs in <span class="genus-species">D. simulans</span> discussed above (<a href="#pgen-0030107-t003">Table 3</a>). Thus, these results suggest that <span class="genus-species">D. melanogaster</span> is the most likely lineage in which <i>hydra</i> has experienced positive selection.</p> <div class="figure" xpathLocation="/article[1]/body[1]/sec[2]/sec[5]/table-wrap[3]"><a name="pgen-0030107-t004" id="pgen-0030107-t004" title="Click for larger image " href="/article/slideshow.action?uri=info:doi/10.1371/journal.pgen.0030107&imageURI=info:doi/10.1371/journal.pgen.0030107.t004" onclick="window.open(this.href,'plosSlideshow','directories=no,location=no,menubar=no,resizable=yes,status=no,scrollbars=yes,toolbar=no,height=600,width=850');return false;"><img xpathLocation="noSelect" border="1" src="/article/fetchObject.action?uri=info:doi/10.1371/journal.pgen.0030107.t004&representation=PNG_S" align="left" alt="thumbnail" class="thumbnail"></a><p><strong xpathLocation="/article[1]/body[1]/sec[2]/sec[5]/table-wrap[3]/label[1]"><a href="/article/slideshow.action?uri=info:doi/10.1371/journal.pgen.0030107&imageURI=info:doi/10.1371/journal.pgen.0030107.t004" onclick="window.open(this.href,'plosSlideshow','directories=no,location=no,menubar=no,resizable=yes,status=no,scrollbars=yes,toolbar=no,height=600,width=850');return false;"><span xpathLocation="/article[1]/body[1]/sec[2]/sec[5]/table-wrap[3]/label[1]">Table 4. </span></a></strong></p><p xpathLocation="/article[1]/body[1]/sec[2]/sec[5]/table-wrap[3]/caption[1]/p[1]">MK Tests for Nonneutral Evolution of <i>hydra</i></p> <span xpathLocation="noSelect">doi:10.1371/journal.pgen.0030107.t004</span><div class="clearer"></div></div><p xpathLocation="/article[1]/body[1]/sec[2]/sec[5]/p[4]">To confirm this conclusion, we tested to see if the nonneutral evolution of <i>hydra</i> occurred in a lineage-specific pattern by performing polarized substitution analysis with the MK test (<a href="#pgen-0030107-t004">Table 4</a>). Replacements were polarized to each species lineage using <i>D. yakuba hydra</i> as an outgroup sequence. The polarized MK test is significant only in the <span class="genus-species">D. melanogaster</span> lineage.</p> </div> <div xmlns:xs="http://www.w3.org/2001/XMLSchema" xmlns:xlink="http://www.w3.org/1999/xlink" xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:aml="http://topazproject.org/aml/" id="section3" xpathLocation="/article[1]/body[1]/sec[3]"><a id="s3" name="s3" toc="s3" title="Discussion"></a><h3 xpathLocation="noSelect">Discussion <a href="#top">Top</a></h3> <h4 xpathLocation="/article[1]/body[1]/sec[3]/sec[1]/title[1]"><i>hydra</i> Is a Recently Originated Functional Gene</h4> <p xpathLocation="/article[1]/body[1]/sec[3]/sec[1]/p[1]">We identified the gene <i>hydra</i> in <i>D. melanogaster,</i> but could only identify orthologs within other <i>melanogaster</i> subgroup species. Using both BLAST searches of full-genome sequences with the 6-kb region flanking <i>hydra</i> and Southern hybridization, we were unable to identify <i>hydra</i> from <i>D. ananassae, D. pseudoobscura,</i> or <i>D. virilis.</i> We were, however, able to identify the syntenic region in these species (<a href="#pgen-0030107-g001">Figure 1</a>B). These data strongly suggest that <i>hydra</i> originated in the common ancestor of the <i>melanogaster</i> subgroup.</p> <p xpathLocation="/article[1]/body[1]/sec[3]/sec[1]/p[2]">All available evidence also suggests that <i>hydra</i> is a functional gene. First, all <i>melanogaster</i> subgroup species contain intact open reading frames with no stop codons, even though there are many insertions and deletions in the <i>hydra</i> CDS among species. Second, Ka/Ks values between all species are less than 1, suggesting that <i>hydra</i> is under functional constraint (<a href="#pgen-0030107-t002">Table 2</a>). Third, the level of polymorphism of <i>hydra</i> in <span class="genus-species">D. melanogaster</span> is similar to known functionally important genes (<a href="#pgen-0030107-t003">Table 3</a>). Fourth, RT-PCR and in situ hybridization show that <i>hydra</i> is predominantly expressed in male testes (<a href="#pgen-0030107-g004">Figures 4</a> and <a href="#pgen-0030107-g005">5</a>).</p> <h4 xpathLocation="/article[1]/body[1]/sec[3]/sec[2]/title[1]"><i>hydra</i> Shares Common Features of New-Gene Evolution</h4> <p xpathLocation="/article[1]/body[1]/sec[3]/sec[2]/p[1]">Several other cases of new-gene evolution in <i>Drosophila</i> have been studied [<a href="#pgen-0030107-b002">2</a>,<a href="#pgen-0030107-b048">48</a>]. Examples include (1) <i>Jingwei,</i> a chimeric gene that evolved as a result of the insertion of an <i>Adh</i> retrosequence into a duplicated locus in the <i>D. teissieri/D. yakuba</i> lineage [<a href="#pgen-0030107-b019">19</a>]; (2) <i>Sdic,</i> which originated through a complex set of rearrangements, including a gene fusion between the gene encoding the cell adhesion protein annexin X and a cytoplasmic dynein intermediate chain (<i>Sdic</i> encodes a novel sperm-specific dynein found only in <span class="genus-species">D. melanogaster</span>) [<a href="#pgen-0030107-b049">49</a>]; (3) <i>Sphinx,</i> a recently evolved gene apparently created by both retroposition and exon shuffling, which produces a novel noncoding RNA gene found only in <span class="genus-species">D. melanogaster</span> [<a href="#pgen-0030107-b033">33</a>]; (4) <i>mkg,</i> a gene family generated originally as retroposed duplicates about 1–2 million y ago that further evolved by individual members undergoing gene fission and fusion events [<a href="#pgen-0030107-b035">35</a>]; (5) <i>K81,</i> a gene that arose through duplication by retroposition after the radiation of the <i>melanogaster</i> subgroup and acquired a new male germline–specific function [<a href="#pgen-0030107-b050">50</a>]; (6) <i>Dntf-2r,</i> a rapidly evolving male-specific gene in <span class="genus-species">D. melanogaster</span> and sibling species, which originated from retroposition [<a href="#pgen-0030107-b034">34</a>]; and (7) five protein-coding genes which appear to have originated in <span class="genus-species">D. melanogaster</span> from noncoding DNA and evolved male-biased expression [<a href="#pgen-0030107-b006">6</a>].</p> <p xpathLocation="/article[1]/body[1]/sec[3]/sec[2]/p[2]">Despite the diverse mechanisms involved in the creation of these young genes in <i>Drosophila,</i> there are two features common to most of them: (1) they evolve rapidly in sequence, including at nonsynonymous sites for protein-coding genes [<a href="#pgen-0030107-b019">19</a>,<a href="#pgen-0030107-b020">20</a>,<a href="#pgen-0030107-b034">34</a>,<a href="#pgen-0030107-b049">49</a>,<a href="#pgen-0030107-b051">51</a>,<a href="#pgen-0030107-b052">52</a>]; and (2) their expression is often male-specific, and in many cases testis-specific [<a href="#pgen-0030107-b006">6</a>,<a href="#pgen-0030107-b052">52</a>]. This expression pattern was also often found in a large survey of new retroposed genes [<a href="#pgen-0030107-b017">17</a>].</p> <p xpathLocation="/article[1]/body[1]/sec[3]/sec[2]/p[3]"><i>hydra</i> shares both of these characteristics. The Ka and Ks values between <span class="genus-species">D. melanogaster</span> and <i>D. simulans</i> were substantially higher than the average values of most other genes, and the Ka/Ks ratio ranged from 0.44 to 0.75 in all species compared (<a href="#pgen-0030107-t002">Table 2</a>). These high values may be explained by accelerated functional divergence following the origin of new genes. However, the elevated Ka/Ks ratio could also result from an elevated mutation rate and reduced selective constraint. To further investigate the evolution of <i>hydra,</i> we analyzed the level of polymorphism and divergence among <i>D. melanogaster, D. simulans,</i> and <i>D. yakuba.</i> Our population genetics analyses rejected the null hypothesis of neutral evolution in <span class="genus-species">D. melanogaster</span> (<a href="#pgen-0030107-t004">Table 4</a>). This rejection appears to be due to a significant excess of fixed differences at nonsynonymous sites in <i>D. melanogaster,</i> suggesting that positive selection has driven the evolution of <i>hydra</i> in <i>D. melanogaster.</i></p> <h4 xpathLocation="/article[1]/body[1]/sec[3]/sec[3]/title[1]"><i>hydra</i> Is Expressed in the Basal Part of the Testis</h4> <p xpathLocation="/article[1]/body[1]/sec[3]/sec[3]/p[1]">The male-specific expression pattern is a second feature that <i>hydra</i> shares with other new genes. For many newly evolved genes, male-specific or testis-specific expression has been demonstrated by RT-PCR, but the spatial expression patterns are unknown, making it difficult to refine our knowledge of what aspects of testis development or spermatogenesis may be under selection. We determined that <i>hydra</i> is expressed most intensely in the basal (proximal) part of the testis in <span class="genus-species">D. melanogaster</span> by in situ hybridization (<a href="#pgen-0030107-g005">Figure 5</a>). This localization pattern suggests that <i>hydra</i> may have a function in late-stage spermatogenesis or sperm differentiation. We note that <i>hydra</i> is X-linked, which suggests that it escapes from the X inactivation that occurs during spermatogenesis [<a href="#pgen-0030107-b053">53</a>]. Our results also stand in contrast to results from genome-wide studies that suggest that genes with male-biased expression as well as newly evolved testis-specific genes tend to be autosomal [<a href="#pgen-0030107-b017">17</a>,<a href="#pgen-0030107-b054">54</a>,<a href="#pgen-0030107-b055">55</a>]. Interestingly, the newly evolved testis-expressed genes <i>Sdic</i> and <i>CG15323</i> are also located in polytene region 19 of the X chromosome [<a href="#pgen-0030107-b006">6</a>,<a href="#pgen-0030107-b049">49</a>].</p> <p xpathLocation="/article[1]/body[1]/sec[3]/sec[3]/p[2]">Several studies have shown that genes with male-biased expression have significantly faster rates of evolution than genes with female-biased or unbiased expression [<a href="#pgen-0030107-b056">56</a>,<a href="#pgen-0030107-b057">57</a>]. This difference is caused primarily by a higher Ka in the male-biased genes. Sexual selection is likely to be driving this acceleration of male-biased genes, but functional tests will be required to understand fully the role of selection. Our study of <i>hydra</i> suggests that late-stage spermatogenesis may be the key developmental process to investigate further for functional differences between species.</p> <h4 xpathLocation="/article[1]/body[1]/sec[3]/sec[4]/title[1]">Novel Aspects of <i>hydra: hydra</i> Has Undergone Recurrent Structural Evolution</h4> <p xpathLocation="/article[1]/body[1]/sec[3]/sec[4]/p[1]">Our analysis of <i>hydra</i> reveals several aspects that are unusual or unique compared with other newly evolved genes. One novel feature of <i>hydra</i> is that it has experienced recurrent structural evolution in the lineages leading to both <span class="genus-species">D. melanogaster</span> and <span class="genus-species">D. simulans</span> (<a href="#pgen-0030107-g001">Figure 1</a>). We can infer the likely occurrence of three independent structural changes to <i>hydra.</i> One is a duplication of exon 1 in the common ancestor of <span class="genus-species">D. simulans</span> and <i>D. sechellia.</i> Second is a duplication of the whole locus in <span class="genus-species">D. simulans</span> and <i>D. sechellia.</i> Although uncertainties remain about the structure of the <i>hydra</i> region in <i>D. sechellia,</i> our phylogenetic analyses suggest that <i>hydra</i> duplicated independently in these two species. Third is the further duplication of seven additional exon 1s in <i>D. melanogaster.</i> Our phylogenetic analysis suggests that these additional duplication events occurred only in <i>D. melanogaster,</i> rather than in the common ancestor of <i>D. melanogaster, D. simulans,</i> and <i>D. sechellia,</i> followed by loss in the latter two species. It is possible, however, that the phylogenetic signal could be erroneous if homogenization occurred by continual gene conversion and/or unequal crossing over among these short duplicated exons.</p> <p xpathLocation="/article[1]/body[1]/sec[3]/sec[4]/p[2]">The duplicated exon 1 in <span class="genus-species">D. simulans</span> and <span class="genus-species">D. sechellia</span> and most of the additional exon 1 duplications in <span class="genus-species">D. melanogaster</span> are flanked by partial <i>DINE-1</i> elements. <i>DINE-1</i> is not associated with <i>hydra</i> in <span class="genus-species">D. yakuba</span> or <i>D. erecta.</i> Genome-wide analyses of <i>DINE-1</i> suggest that <i>DINE-1</i> was transpositionally active and then silenced in the common ancestor of <span class="genus-species">D. melanogaster</span> and <i>D. yakuba,</i> followed by another round of activity and silencing in <span class="genus-species">D. yakuba</span> [<a href="#pgen-0030107-b039">39</a>]. These findings would suggest then that <i>DINE-1</i> inserted ancestrally in <i>hydra,</i> followed by loss in the <span class="genus-species">D. yakuba</span> lineage but not the <span class="genus-species">D. melanogaster</span> lineage. An alternative scenario is that <i>DINE-1</i> may have inserted in <i>hydra</i> during a period of activity in the <i>D. melanogaster/D. simulans</i> ancestor after divergence from <span class="genus-species">D. yakuba</span> that was too brief to have a left a genome-wide footprint.</p> <p xpathLocation="/article[1]/body[1]/sec[3]/sec[4]/p[3]">Regardless of the timing of the initial <i>DINE-1</i> insertion into <i>hydra,</i> the further duplications of exon 1 in <span class="genus-species">D. melanogaster</span> were unlikely to have occurred by <i>DINE-1</i> transposition because alternative exon 1s two through eight contain UTR and CDSs that are adjacent to rather than within the <i>DINE-1</i> sequences. As noted above, the phylogenetic relationships among these alternative exons 1s suggest that they originated by unequal crossing over. <i>DINE-1</i> may have promoted these duplications by increasing the homology among exon 1s. While we lack evidence for a direct role of <i>DINE-1</i> in driving <i>hydra</i> structural evolution, our results do suggest that a property of transposable elements that is usually considered to be deleterious—their ability to cause ectopic recombination and unequal crossing over—may also contribute to structural evolution of genes. We have observed other cases of structural variation associated with <i>DINE-1</i> insertions in the <i>melanogaster</i> species complex (unpublished data). For most genes, evolving under strong functional constraint, a <i>DINE-1</i> insertion that causes structural changes in the locus is likely to be highly deleterious. However, for a newly evolved gene like <i>hydra,</i> there may be more flexibility in terms of tolerating gene structure changes. We also suggest that as a gene evolves in structure, it may accelerate the rate of CDS evolution.</p> <p xpathLocation="/article[1]/body[1]/sec[3]/sec[4]/p[4]">More generally, our evidence that <i>hydra</i> has undergone multiple and independent structural changes suggests that gene structure as well as CDSs may evolve rapidly in new genes, even without any association with transposable elements. One other example is the <i>monkey king</i> gene family in <i>Drosophila,</i> which has undergone rapid structural changes caused by gene fission [<a href="#pgen-0030107-b035">35</a>].</p> <h4 xpathLocation="/article[1]/body[1]/sec[3]/sec[5]/title[1]"><i>hydra</i> Expression Level Is Evolving</h4> <p xpathLocation="/article[1]/body[1]/sec[3]/sec[5]/p[1]">A second novel aspect compared with other studies of newly evolved genes is that <i>hydra</i> expression level has dramatically changed between sibling species. Our quantitative RT-PCR results showed that the expression level of <i>hydra</i> between <span class="genus-species">D. melanogaster</span> and <span class="genus-species">D. simulans</span> is highly different (<a href="#pgen-0030107-g006">Figure 6</a>). <i>hydra</i> in <span class="genus-species">D. melanogaster</span> is expressed at least 20-fold less on average than in <i>D. simulans.</i> Why is the expression level so different between these two closely related species?</p> <p xpathLocation="/article[1]/body[1]/sec[3]/sec[5]/p[2]">Two hypotheses may explain the decreased <i>hydra</i> expression in <i>D. melanogaster.</i> First, it may be caused by competition or interference among the tandemly duplicated heads during the transcription initiation stage. In this model, incomplete transcription initiation complexes would form at multiple heads. Reduced transcription initiation could result from either sequestration of transcription factors or direct interference among promoters. Second, it may be the result of differences in the degree of heterochromatinization of the <i>hydra</i> region between <span class="genus-species">D. melanogaster</span> and <i>D. simulans. hydra</i> is located near the pericentromeric region of the X chromosome. This region may be under continuous pressure from encroachment of the nearby heterochromatic pericentromere, leading to species-specific differences in chromatin states. Increased numbers of TE insertions are one characteristic of heterochromatic regions, and the large number of <i>DINE-1</i> insertions in <span class="genus-species">D. melanogaster</span> is consistent with the hypothesis that the <i>hydra</i> region is partially heterochromatic.</p> <p xpathLocation="/article[1]/body[1]/sec[3]/sec[5]/p[3]">Our views on the evolution of genome structure and function have changed dramatically in the past decade as more whole-genome sequences have become available in various species. Repetitive elements are a major cause of structural changes and instability in genomes. At the cytological level, chromosome rearrangements often occur at repetitive sites [<a href="#pgen-0030107-b031">31</a>,<a href="#pgen-0030107-b058">58</a>,<a href="#pgen-0030107-b059">59</a>]. Our identification of the <i>hydra</i> gene suggests that repetitive elements also contribute to the formation and evolution of new genes by causing structural changes in gene organization, driving the evolution of new exons and transcription start sites, and promoting divergence in gene expression.</p> <h4 xpathLocation="/article[1]/body[1]/sec[3]/sec[6]/title[1]"><i>hydra</i> Is a Rare Example of De Novo Gene Creation</h4> <p xpathLocation="/article[1]/body[1]/sec[3]/sec[6]/p[1]">One of our most striking findings is that <i>hydra</i> appears to have been created de novo rather than being a duplicate of a pre-existing gene. Two pieces of evidence support this hypothesis. First, <i>hydra</i> (and <i>CG1835</i>) are found only in <i>melanogaster</i> subgroup species. The surrounding ~26 kb of DNA is found in other <i>Drosophila</i> species that lack <i>hydra</i> (<a href="#pgen-0030107-g001">Figure 1</a>B). Second, <i>hydra</i> shares no homology with any known or predicted proteins. Arguing against this hypothesis of de novo origin is the fact that all forms of <i>hydra</i> contain four predicted exons. One might expect that a recently evolved de novo gene would have a simpler one-exon structure, as has been observed for several candidate de novo genes in <span class="genus-species">D. melanogaster</span> [<a href="#pgen-0030107-b006">6</a>]. Nevertheless, if <i>hydra</i> does have an ortholog in <i>Drosophila</i> outside of the <i>melanogaster</i> subgroup, it must have evolved so rapidly as to share no detectable similarity with any predicted proteins, including in multiple <i>Drosophila</i> genomes or other insect genomes that have been completely sequenced. If there is a highly diverged <i>hydra</i> parental gene or ortholog in other <i>Drosophila,</i> it also must have transposed to a novel genomic location in the <i>melanogaster</i> subgroup. Considering all the available data, we suggest instead that <i>hydra</i> evolved de novo from DNA sequence that inserted between <i>run</i> and <i>cyp6v1</i> in the common ancestor of the <i>melanogaster</i> subgroup.</p> <h4 xpathLocation="/article[1]/body[1]/sec[3]/sec[7]/title[1]">The Dynamic Nature of New Genes</h4> <p xpathLocation="/article[1]/body[1]/sec[3]/sec[7]/p[1]">The most common fate of newly formed genes is disappearance. For example, about 85% of the genes duplicated during the yeast whole-genome duplication have been lost in <span class="genus-species">Saccharomyces cerevisiae</span> [<a href="#pgen-0030107-b003">3</a>,<a href="#pgen-0030107-b060">60</a>]. New genes therefore can be viewed as analogous to mutations, with most being neutral or deleterious in effect and therefore subject to elimination. A common characteristic of successful new exons and new genes is a high rate of CDS evolution [<a href="#pgen-0030107-b007">7</a>,<a href="#pgen-0030107-b020">20</a>], and <i>hydra</i> shows this evolutionary pattern. Our discovery of <i>hydra</i> suggests that gene expression level and gene structure may also evolve rapidly and recurrently in new genes. We suggest that the successful retention of new genes requires maximal variation.</p> </div> <div xmlns:xs="http://www.w3.org/2001/XMLSchema" xmlns:xlink="http://www.w3.org/1999/xlink" xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:aml="http://topazproject.org/aml/" id="section4" xpathLocation="/article[1]/body[1]/sec[4]"><a id="s4" name="s4" toc="s4" title="Materials and Methods"></a><h3 xpathLocation="noSelect">Materials and Methods <a href="#top">Top</a></h3> <h4 xpathLocation="/article[1]/body[1]/sec[4]/sec[1]/title[1]">Fly strains.</h4> <p xpathLocation="/article[1]/body[1]/sec[4]/sec[1]/p[1]">Flies used in this study include: (1) isofemale lines of <span class="genus-species">D. melanogaster</span> (WI) from Sergey Nuzhdin (University of California Davis, Winters, California, United States); (2) strains of <span class="genus-species">D. melanogaster</span> from worldwide populations: California (CA), Canton S (CS), Taiwan (TWN), Oregon R (ORC), France 3V-1 (Fr3V-1) (gift of S. C. Tsaur, Academia Sinica, Taiwan); (3) isofemale lines of <span class="genus-species">D. simulans</span> from African populations (mad, sz, su, zk lines; gift of John Pool, Cornell University, Ithaca, New York, United States), and one line each from France (W54) and Japan (W60); (4) isofemale lines of <span class="genus-species">D. yakuba</span> (cy lines) from Africa (gift of Peter Andolfatto, University of California San Diego, United States); and (5) strains of <i>Drosophila</i> species, including <i>D. yakuba</i> (Tai18E2, and 286.82–90), <i>D. erecta, D. ananassae, D. virilis,</i> and <span class="genus-species">D. pseudoobscura</span> (gift of S. C. Tsaur).</p> <h4 xpathLocation="/article[1]/body[1]/sec[4]/sec[2]/title[1]">DNA preparation and analysis of DNA sequences.</h4> <p xpathLocation="/article[1]/body[1]/sec[4]/sec[2]/p[1]">DNA was extracted from pools of ~50 male flies from each line by a standard phenol-chloroform extraction followed by ethanol precipitation. Primers to amplify and sequence the <i>hydra</i> gene regions from <i>D. melanogaster, D</i>. <i>simulans,</i> and <span class="genus-species">D. yakuba</span> were designed using the homologous sequences obtained from BLAST searches against Flybase genome databases (<a href="http://www.flybase.org/blast">http://www.flybase.org/blast</a>). Primers for both <span class="genus-species">D. melanogaster</span> and <span class="genus-species">D. simulans</span> are IN1_F (5′-GCGTTTGTACACTTGGCAAC) and 3UR (5′-TGATGTAGGAATATGCGTTGC), and for <span class="genus-species">D. yakuba</span> are yakE2_F (5′-CTTCAGAGAACCCCAACCAA) and yakE3_R (5′-CTTGCAATTATCCGGATTGC). In <i>D. simulans,</i> the primer pair specifically amplifies the second duplicate of <i>hydra,</i> which is adjacent to the S3 alternative exon 1 (<a href="#pgen-0030107-g001">Figure 1</a>B). Other primer sequences and PCR amplification conditions are available upon request. PCR products were directly sequenced in both direction using ABI BigDye (Applied Biosystems, <a href="http://www.appliedbiosystems.com">http://www.appliedbiosystems.com</a>) technologies under slight modification of the manufacturer's suggested protocols. All alleles were sequenced on both strands. Sequences are deposited in GenBank (<a href="http://www.ncbi.nlm.nih.gov/Genbank">http://www.ncbi.nlm.nih.gov/Genbank</a>) under accession numbers EF596837–EF596877.</p> <h4 xpathLocation="/article[1]/body[1]/sec[4]/sec[3]/title[1]">Southern hybridization.</h4> <p xpathLocation="/article[1]/body[1]/sec[4]/sec[3]/p[1]">Genomic DNA was extracted from 60–70 flies of each line with phenol-chloroform, was ethanol precipitated, and was diluted to a final concentration of about 5 μg/μl. A total of 15 μg DNA was then digested separately with SacII, separated on a 0.8% agarose gel, and transferred to a nylon membrane by Southern blotting. Probes were from PCR product using DNA template from <span class="genus-species">D. melanogaster</span> with primers hydra_rep500_R2 (5′-CAGT(T/C)AGACCTCTCTGAAATC) and E2_146R (5′- GGTTGGAATCCTCTGGAGTGTTGG), and were prepared by DIG-labeling Nick translation kit (Roche, <a href="http://www.roche.com">http://www.roche.com</a>). Hybridizations were done at 50 °C.</p> <h4 xpathLocation="/article[1]/body[1]/sec[4]/sec[4]/title[1]">RNA preparation, RT-PCR, 5′- RACE, and molecular cloning.</h4> <p xpathLocation="/article[1]/body[1]/sec[4]/sec[4]/p[1]">Testes of adult males aged 2–5 d old were dissected in PBS buffer and immediately transferred to PBS buffer on ice. RNAs were extracted with Trizol (Invitrogen, <a href="http://www.invitrogen.com">http://www.invitrogen.com</a>). After a brief vortex mixing, the mixture was incubated at 4 °C for 15 min and then centrifuged at low speed to obtain phase separation. The aqueous phase was transferred to a fresh tube, to which an equal volume of isopropanol was added in the presence of 3 μl glycogen. The mixture was kept at −20 °C for 30 min, followed by centrifugation. The RNA pellet thus obtained was washed with 70% chilled ethanol, repelleted, and air dried. The final RNA pellet was dissolved in 20 μl DEPC-treated distilled water and was used in at least two RT reactions.</p> <p xpathLocation="/article[1]/body[1]/sec[4]/sec[4]/p[2]">RT was performed using the Superscript II RT kit obtained from Life Technologies (<a href="http://www.invitrogen.com">http://www.invitrogen.com</a>) using oligo(dT)<sub>12–18</sub> as the primer. The RT products were dissolved in 20 μl sterile distilled water and 1 μl was used for each PCR. For 5′-RACE), first strand synthesis using the lock-docking oligo(dT) primer and 35 cycles of PCR amplification were performed using the SMART RACE cDNA Amplification Kit purchased from Clontech (<a href="http://www.clontech.com">http://www.clontech.com</a>). The <i>hydra</i>-specific primers used in this study are E3_110R (5′-TGGATTTTACGCCGCTCCT). 5′ RACE–derived PCR products were subcloned into the pGEM-T vector (Promega, <a href="http://www.promega.com">http://www.promega.com</a>) using a standard cloning procedure, and 61 clones were picked randomly for DNA sequencing.</p> <h4 xpathLocation="/article[1]/body[1]/sec[4]/sec[5]/title[1]">Quantitative PCR.</h4> <p xpathLocation="/article[1]/body[1]/sec[4]/sec[5]/p[1]">A total of 50 testes of each line were collected from 3-d-old males. Testes were homogenized in Trizol (Invitrogen), and total RNA was phenol-chloroform extracted, ethanol precipitated, and cleaned up with RNeasy mini kit (Qiagen, <a href="http://www.qiagen.com">http://www.qiagen.com</a>) and RNase free DNase Set (Qiagen). About 200 ng of total RNA was used for synthesizing cDNA with TaqMan Reverse Transcription Reagents (Applied Biosystems) using oligo-dT as the primer, following the manufacturer's instruction.</p> <p xpathLocation="/article[1]/body[1]/sec[4]/sec[5]/p[2]">Quantitative real-time PCR (qPCR) was performed using the Lightcycler-FastStart DNA Master SYBR Green I kit (Roche), according to the manufacturer's instructions. Primers used were E2_222F (5′-ATGTGGCAAAGGTCCAGAAT) and E3_110R (5′-TGGATTTTACGCCGCTCCT), which are complementary to exon 2 and 3 of <i>hydra,</i> respectively. Note that this primer pair cannot distinguish transcripts derived from the two duplicates of <i>hydra</i> in <i>D. simulans.</i> PCR quality and specificity was verified by melting curve dissociation analysis and gel electrophoresis of the amplified products. Relative transcript abundance of <i>hydra</i> was calculated using the second derivative maximum values from the linear regression of cycle number versus log concentration of the amplified gene. Amplification of the control gene <i>GADPH</i> was used for normalization. Sequences of the primers used are GADPH_F: 5′-AAGGGAATCCTGGGCTACAC and GADPH_R: 5′-CGGTTGGAGTAACCGAACTC.</p> <h4 xpathLocation="/article[1]/body[1]/sec[4]/sec[6]/title[1]">In situ hybridization.</h4> <p xpathLocation="/article[1]/body[1]/sec[4]/sec[6]/p[1]">Digoxigenin-labeled antisense and sense control riboprobes were generated from a cDNA containing the sequence of exon 2 and 3 of <i>hydra</i> cloned into a pBluescript vector. Probes were synthesized using DIG RNA labeling mix (Roche), followed by treatment with 2 U DNAse (Promega) and incubation in carbonate buffer for 40 min at 65 °C as described in [<a href="#pgen-0030107-b061">61</a>]. Probes were then ethanol precipitated, air dried, and resuspended in 200 μl hybridization buffer. Probes were used at a dilution of 1:50 during hybridization.</p> <p xpathLocation="/article[1]/body[1]/sec[4]/sec[6]/p[2]">Testes were dissected in 1× PBS and kept on ice until fixation. Two fixations were done with 4% formaldehyde in 1× PBS for 20 min on ice. After washing twice in PBS/0.1% Triton-X, protease treatment and all following steps were done as described in [<a href="#pgen-0030107-b061">61</a>]. Hybridizations were done at 60 °C overnight.</p> <h4 xpathLocation="/article[1]/body[1]/sec[4]/sec[7]/title[1]">Identification of <i>hydra</i> orthologs.</h4> <p xpathLocation="/article[1]/body[1]/sec[4]/sec[7]/p[1]">Orthologs of <i>hydra</i> were from the following prepublication genome sequences: <span class="genus-species">D. simulans</span> and <span class="genus-species">D. yakuba</span> sequence from the Washington University Genome Sequencing Center (<a href="http://genome.wustl.edu">http://genome.wustl.edu</a>); <span class="genus-species">D. sechellia</span> sequence from the Broad Institute (<a href="http://www.broad.mit.edu">http://www.broad.mit.edu</a>); and <span class="genus-species">D. erecta</span> sequence from Agencourt Bioscience (<a href="http://www.agencourt.com">http://www.agencourt.com</a>). Sequences of <i>hydra</i> from these species were annotated by maximizing homology to the <span class="genus-species">D. melanogaster</span> sequence, and are shown in <a href="#pgen-0030107-se001">Texts S1</a>–<a href="#pgen-0030107-se006">S6</a>.</p> <h4 xpathLocation="/article[1]/body[1]/sec[4]/sec[8]/title[1]">Sequence analysis.</h4> <p xpathLocation="/article[1]/body[1]/sec[4]/sec[8]/p[1]">Sequences were aligned using ClustalW [<a href="#pgen-0030107-b062">62</a>], with some manual adjustment to keep gaps in-frame in coding regions. Phylogenetic analyses were performed using Mega 3.1 [<a href="#pgen-0030107-b063">63</a>]. Sequence polymorphism and divergence analysis were done using DnaSP 4.10 [<a href="#pgen-0030107-b064">64</a>]. The effective number of synonymous and nonsynonymous sites, Ka and Ks values, and pairwise divergence for synonymous sites based on Kimura's two-parameter model were estimated.</p> </div> <div xmlns:xs="http://www.w3.org/2001/XMLSchema" xmlns:xlink="http://www.w3.org/1999/xlink" xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:aml="http://topazproject.org/aml/" id="section5" xpathLocation="/article[1]/body[1]/sec[5]"><a id="s5" name="s5" toc="s5" title="Supporting Information"></a><h3 xpathLocation="noSelect">Supporting Information <a href="#top">Top</a></h3><a name="pgen-0030107-se001" id="pgen-0030107-se001"></a><p><strong xPathLocation="noSelect"><a href="/article/fetchSingleRepresentation.action?uri=info:doi/10.1371/journal.pgen.0030107.sd001">Text S1. </a>Annotation in GenBank Format of <i>hydra</i> Region Sequences in <span class="genus-species">D. melanogaster</span></strong></p><p xpathLocation="/article[1]/body[1]/sec[5]/supplementary-material[1]/caption[1]/p[1]">(54 KB TXT)</p> <a name="pgen-0030107-se002" id="pgen-0030107-se002"></a><p><strong xPathLocation="noSelect"><a href="/article/fetchSingleRepresentation.action?uri=info:doi/10.1371/journal.pgen.0030107.sd002">Text S2. </a>Annotation in GenBank Format of <i>hydra</i> Region Sequences in <span class="genus-species">D. simulans</span></strong></p><p xpathLocation="/article[1]/body[1]/sec[5]/supplementary-material[2]/caption[1]/p[1]">(71 KB TXT)</p> <a name="pgen-0030107-se003" id="pgen-0030107-se003"></a><p><strong xPathLocation="noSelect"><a href="/article/fetchSingleRepresentation.action?uri=info:doi/10.1371/journal.pgen.0030107.sd003">Text S3. </a>Annotation in GenBank Format of <i>hydra</i> Region Sequences in <i>D. sechellia scaf 8</i></strong></p><p xpathLocation="/article[1]/body[1]/sec[5]/supplementary-material[3]/caption[1]/p[1]">(42 KB TXT)</p> <a name="pgen-0030107-se004" id="pgen-0030107-se004"></a><p><strong xPathLocation="noSelect"><a href="/article/fetchSingleRepresentation.action?uri=info:doi/10.1371/journal.pgen.0030107.sd004">Text S4. </a>Annotation in GenBank Format of <i>hydra</i> Region Sequences in <i>D. sechellia scaf 600</i></strong></p><p xpathLocation="/article[1]/body[1]/sec[5]/supplementary-material[4]/caption[1]/p[1]">(13 KB TXT)</p> <a name="pgen-0030107-se005" id="pgen-0030107-se005"></a><p><strong xPathLocation="noSelect"><a href="/article/fetchSingleRepresentation.action?uri=info:doi/10.1371/journal.pgen.0030107.sd005">Text S5. </a>Annotation in GenBank Format of <i>hydra</i> Region Sequences in <span class="genus-species">D. yakuba</span></strong></p><p xpathLocation="/article[1]/body[1]/sec[5]/supplementary-material[5]/caption[1]/p[1]">(43 KB TXT)</p> <a name="pgen-0030107-se006" id="pgen-0030107-se006"></a><p><strong xPathLocation="noSelect"><a href="/article/fetchSingleRepresentation.action?uri=info:doi/10.1371/journal.pgen.0030107.sd006">Text S6. </a>Annotation in GenBank Format of <i>hydra</i> Region Sequences in <span class="genus-species">D. erecta</span></strong></p><p xpathLocation="/article[1]/body[1]/sec[5]/supplementary-material[6]/caption[1]/p[1]">(43 KB TXT)</p> <a name="pgen-0030107-se007" id="pgen-0030107-se007"></a><p><strong xPathLocation="noSelect"><a href="/article/fetchSingleRepresentation.action?uri=info:doi/10.1371/journal.pgen.0030107.sd007">Text S7. </a>Alignments in FASTA Format of <i>hydra</i> Exons 2–4 Used for the Phylogenetic Analysis in <a href="#pgen-0030107-g003">Figure 3</a></strong></p><p xpathLocation="/article[1]/body[1]/sec[5]/supplementary-material[7]/caption[1]/p[1]">(7 KB TXT)</p> <a name="pgen-0030107-se008" id="pgen-0030107-se008"></a><p><strong xPathLocation="noSelect"><a href="/article/fetchSingleRepresentation.action?uri=info:doi/10.1371/journal.pgen.0030107.sd008">Text S8. </a>Alignments in FASTA Format of <i>hydra</i> Exon 1 (Including Predicted 5′ UTRs) Used for the Phylogenetic Analysis in <a href="#pgen-0030107-g003">Figure 3</a></strong></p><p xpathLocation="/article[1]/body[1]/sec[5]/supplementary-material[8]/caption[1]/p[1]">(5 KB TXT)</p> <a name="pgen-0030107-se009" id="pgen-0030107-se009"></a><p><strong xPathLocation="noSelect"><a href="/article/fetchSingleRepresentation.action?uri=info:doi/10.1371/journal.pgen.0030107.sd009">Text S9. </a>Alignment of All DNA Sequences Used in the Polymorphism and Divergence Analyses</strong></p><p xpathLocation="/article[1]/body[1]/sec[5]/supplementary-material[9]/caption[1]/p[1]">(84 KB TXT)</p> <a name="pgen-0030107-se010" id="pgen-0030107-se010"></a><p><strong xPathLocation="noSelect"><a href="/article/fetchSingleRepresentation.action?uri=info:doi/10.1371/journal.pgen.0030107.sd010">Text S10. </a>Alignment of Amino Acid Sequences Based on the DNA Alignment in <a href="#pgen-0030107-se009">Text S9</a></strong></p><p xpathLocation="/article[1]/body[1]/sec[5]/supplementary-material[10]/caption[1]/p[1]">(12 KB TXT)</p> </div> <div xmlns:xs="http://www.w3.org/2001/XMLSchema" xmlns:xlink="http://www.w3.org/1999/xlink" xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:aml="http://topazproject.org/aml/" xpathLocation="noSelect"><a id="ack" name="ack" toc="ack" title="Acknowledgments"></a><h3 xpathLocation="noSelect">Acknowledgments <a href="#top">Top</a></h3> <p xpathLocation="/article[1]/back[1]/ack[1]/p[1]">We thank Daven Presgraves and Henry Sun for helpful discussions, and Manyuan Long and the anonymous reviewers for insightful comments on the manuscript. We also thank Shun-Chern Tsaur, John Pool, Peter Andolfatto, and Sergey Nuzhdin for providing fly strains for population genetics studies, and Hong-Ya Liao for technical assistance.</p> </div><div xmlns:xs="http://www.w3.org/2001/XMLSchema" xmlns:xlink="http://www.w3.org/1999/xlink" xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:aml="http://topazproject.org/aml/" class="contributions"><a id="authcontrib" name="authcontrib" toc="authcontrib" title="Author Contributions"></a><h3 xpathLocation="noSelect">Author Contributions <a href="#top">Top</a></h3><p xpathLocation="noSelect"><span class="capture-id">HPY designed the research. STC, HCC, DAB, and HPY performed the experiments. STC, HCC, and HPY analyzed the data. DAB and HPY wrote the paper.</span></p></div><div xmlns:xs="http://www.w3.org/2001/XMLSchema" xmlns:xlink="http://www.w3.org/1999/xlink" xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:aml="http://topazproject.org/aml/" xpathLocation="noSelect"><a id="references" name="references" toc="references" title="References"></a><h3 xpathLocation="noSelect">References <a href="#top">Top</a></h3><ol class="references" xpathLocation="noSelect"><li xpathLocation="noSelect"><a name="pgen-0030107-b001" id="pgen-0030107-b001"></a><span class="authors">Jacob F</span> (1977) Evolution and tinkering. Science 196: 1161–1166. <a class="find" href="/article/findArticle.action?author=Jacob&title=Evolution and tinkering."> Find this article online </a></li><li xpathLocation="noSelect"><a name="pgen-0030107-b002" id="pgen-0030107-b002"></a><span class="authors">Long M, Betran E, Thornton K, Wang W</span> (2003) The origin of new genes: Glimpses from the young and old. Nat Rev Gen 4: 865–875. <a class="find" href="/article/findArticle.action?author=Long&title=The origin of new genes: Glimpses from the young and old."> Find this article online </a></li><li xpathLocation="noSelect"><a name="pgen-0030107-b003" id="pgen-0030107-b003"></a><span class="authors">Wolfe KH, Shields DC</span> (1997) Molecular evidence for an ancient duplication of the entire yeast genome. Nature 387: 708–713. <a class="find" href="/article/findArticle.action?author=Wolfe&title=Molecular evidence for an ancient duplication of the entire yeast genome."> Find this article online </a></li><li xpathLocation="noSelect"><a name="pgen-0030107-b004" id="pgen-0030107-b004"></a><span class="authors">Doolittle RF</span> (1995) The multiplicity of domains in proteins. Ann Rev Biochem 64: 287–314. <a class="find" href="/article/findArticle.action?author=Doolittle&title=The multiplicity of domains in proteins."> Find this article online </a></li><li xpathLocation="noSelect"><a name="pgen-0030107-b005" id="pgen-0030107-b005"></a><span class="authors">Hayashi Y, Sakata H, Makino Y, Urabe I, Yomo T</span> (2003) Can an arbitrary sequence evolve towards acquiring a biological function? J Mol Evol 56: 162–168. <a class="find" href="/article/findArticle.action?author=Hayashi&title=Can an arbitrary sequence evolve towards acquiring a biological function?"> Find this article online </a></li><li xpathLocation="noSelect"><a name="pgen-0030107-b006" id="pgen-0030107-b006"></a><span class="authors">Levine MT, Jones CD, Kern AD, Lindfors HA, Begun DJ</span> (2006) Novel genes derived from noncoding DNA in <span class="genus-species">Drosophila melanogaster</span> are frequently X-linked and exhibit testis-biased expression. Proc Natl Acad Sci U S A 103: 9935–9939. <a class="find" href="/article/findArticle.action?author=Levine&title=Novel genes derived from noncoding DNA in Drosophila melanogaster are frequently X-linked and exhibit testis-biased expression."> Find this article online </a></li><li xpathLocation="noSelect"><a name="pgen-0030107-b007" id="pgen-0030107-b007"></a><span class="authors">Wang W, Zheng H, Yang S, Yu H, Li J, et al. </span> (2005) Origin and evolution of new exons in rodents. Genome Res 15: 1258–1264. <a class="find" href="/article/findArticle.action?author=Wang&title=Origin and evolution of new exons in rodents."> Find this article online </a></li><li xpathLocation="noSelect"><a name="pgen-0030107-b008" id="pgen-0030107-b008"></a><span class="authors">Kidwell MG, Lisch DR</span> (2000) Transposable elements and host genome evolution. Trends Ecol Evol 15: 95–99. <a class="find" href="/article/findArticle.action?author=Kidwell&title=Transposable elements and host genome evolution."> Find this article online </a></li><li xpathLocation="noSelect"><a name="pgen-0030107-b009" id="pgen-0030107-b009"></a><span class="authors">Kazazian HH Jr.</span> (2004) Mobile elements: Drivers of genome evolution. Science 303: 1626–1632. <a class="find" href="/article/findArticle.action?author=Kazazian&title=Mobile elements: Drivers of genome evolution."> Find this article online </a></li><li xpathLocation="noSelect"><a name="pgen-0030107-b010" id="pgen-0030107-b010"></a><span class="authors">Brookfield JFY</span> (2005) The ecology of the genome-mobile DNA elements and their hosts. Nat Rev Gen 6: 128–136. <a class="find" href="/article/findArticle.action?author=Brookfield&title=The ecology of the genome-mobile DNA elements and their hosts."> Find this article online </a></li><li xpathLocation="noSelect"><a name="pgen-0030107-b011" id="pgen-0030107-b011"></a><span class="authors">Dawkins R</span> (1976) The selfish gene. New York: Oxford University Press. 224 p. </li><li xpathLocation="noSelect"><a name="pgen-0030107-b012" id="pgen-0030107-b012"></a><span class="authors">Elliott DJ</span> (2000) An evolutionarily conserved germ cell-specific hnRNP is encoded by a retrotransposed gene. Hum Mol Gen 9: 2117–2124. <a class="find" href="/article/findArticle.action?author=Elliott&title=An evolutionarily conserved germ cell-specific hnRNP is encoded by a retrotransposed gene."> Find this article online </a></li><li xpathLocation="noSelect"><a name="pgen-0030107-b013" id="pgen-0030107-b013"></a><span class="authors">Volff JN</span> (2006) Turning junk into gold: Domestication of transposable elements and the creation of new genes in eukaryotes. Bioessays 28: 913–922. <a class="find" href="/article/findArticle.action?author=Volff&title=Turning junk into gold: Domestication of transposable elements and the creation of new genes in eukaryotes."> Find this article online </a></li><li xpathLocation="noSelect"><a name="pgen-0030107-b014" id="pgen-0030107-b014"></a><span class="authors">Britten RJ</span> (1997) Mobile elements inserted in the distant past have taken on important functions. Gene 205: 177–182. <a class="find" href="/article/findArticle.action?author=Britten&title=Mobile elements inserted in the distant past have taken on important functions."> Find this article online </a></li><li xpathLocation="noSelect"><a name="pgen-0030107-b015" id="pgen-0030107-b015"></a><span class="authors">Vinckenbosch N, Dupanloup I, Kaessmann H</span> (2006) Evolutionary fate of retroposed gene copies in the human genome. Proc Natl Acad Sci U S A 103: 3220–3225. <a class="find" href="/article/findArticle.action?author=Vinckenbosch&title=Evolutionary fate of retroposed gene copies in the human genome."> Find this article online </a></li><li xpathLocation="noSelect"><a name="pgen-0030107-b016" id="pgen-0030107-b016"></a><span class="authors">Emerson JJ, Kaessmann H, Betran E, Long M</span> (2004) Extensive gene traffic on the mammalian X chromosome. Science 303: 537–540. <a class="find" href="/article/findArticle.action?author=Emerson&title=Extensive gene traffic on the mammalian X chromosome."> Find this article online </a></li><li xpathLocation="noSelect"><a name="pgen-0030107-b017" id="pgen-0030107-b017"></a><span class="authors">Betran E, Thornton K, Long M</span> (2002) Retroposed new genes out of the X in <i>Drosophila</i>. Genome Res 12: 1854–1859. <a class="find" href="/article/findArticle.action?author=Betran&title=Retroposed new genes out of the X in Drosophila."> Find this article online </a></li><li xpathLocation="noSelect"><a name="pgen-0030107-b018" id="pgen-0030107-b018"></a><span class="authors">Nozawa M, Aotsuka T, Tamura K</span> (2005) A novel chimeric gene, <i>siren,</i> with retroposed promoter sequence in the <span class="genus-species">Drosophila bipectinata</span> complex. Genetics 171: 1719–1727. <a class="find" href="/article/findArticle.action?author=Nozawa&title=A novel chimeric gene, siren, with retroposed promoter sequence in the Drosophila bipectinata complex."> Find this article online </a></li><li xpathLocation="noSelect"><a name="pgen-0030107-b019" id="pgen-0030107-b019"></a><span class="authors">Long M, Langley CH</span> (1993) Natural selection and the origin of <i>jingwei,</i> a chimeric processed functional gene in <i>Drosophila</i>. Science 260: 91–95. <a class="find" href="/article/findArticle.action?author=Long&title=Natural selection and the origin of jingwei, a chimeric processed functional gene in Drosophila."> Find this article online </a></li><li xpathLocation="noSelect"><a name="pgen-0030107-b020" id="pgen-0030107-b020"></a><span class="authors">Jones CD, Begun DJ</span> (2005) Parallel evolution of chimeric fusion genes. Proc Natl Acad Sci 102: 11373–11378. <a class="find" href="/article/findArticle.action?author=Jones&title=Parallel evolution of chimeric fusion genes."> Find this article online </a></li><li xpathLocation="noSelect"><a name="pgen-0030107-b021" id="pgen-0030107-b021"></a><span class="authors">Zhang XHF, Chasin LA</span> (2006) Comparison of multiple vertebrate genomes reveals the birth and evolution of human exons. Proc Natl Acad Sci 103: 13427–13432. <a class="find" href="/article/findArticle.action?author=Zhang&title=Comparison of multiple vertebrate genomes reveals the birth and evolution of human exons."> Find this article online </a></li><li xpathLocation="noSelect"><a name="pgen-0030107-b022" id="pgen-0030107-b022"></a><span class="authors">Yang ZY, Boffelli D, Boonmark N, Schwartz K, Lawn R</span> (1998) Apolipoprotein(a) gene enhancer resides within a LINE element. J Biol Chem 273: 891–897. <a class="find" href="/article/findArticle.action?author=Yang&title=Apolipoprotein(a) gene enhancer resides within a LINE element."> Find this article online </a></li><li xpathLocation="noSelect"><a name="pgen-0030107-b023" id="pgen-0030107-b023"></a><span class="authors">Medstrand P, van de Lagemaat LN, Dunn CA, Landry JR, Svenback D, et al. </span> (2005) Impact of transposable elements on the evolution of mammalian gene regulation. Cytogenet Genome Res 110: 342–352. <a class="find" href="/article/findArticle.action?author=Medstrand&title=Impact of transposable elements on the evolution of mammalian gene regulation."> Find this article online </a></li><li xpathLocation="noSelect"><a name="pgen-0030107-b024" id="pgen-0030107-b024"></a><span class="authors">van de Lagemaat LN, Landry JR, Mager DL, Medstrand P</span> (2003) Transposable elements in mammals promote regulatory variation and diversification of genes with specialized functions. Trends Genet 19: 530–536. <a class="find" href="/article/findArticle.action?author=van de Lagemaat&title=Transposable elements in mammals promote regulatory variation and diversification of genes with specialized functions."> Find this article online </a></li><li xpathLocation="noSelect"><a name="pgen-0030107-b025" id="pgen-0030107-b025"></a><span class="authors">Schlenke TA, Begun DJ</span> (2004) Strong selective sweep associated with a transposon insertion in <span class="genus-species">Drosophila simulans</span>. Proc Natl Acad Sci U S A 101: 1626–1631. <a class="find" href="/article/findArticle.action?author=Schlenke&title=Strong selective sweep associated with a transposon insertion in Drosophila simulans."> Find this article online </a></li><li xpathLocation="noSelect"><a name="pgen-0030107-b026" id="pgen-0030107-b026"></a><span class="authors">Jordan IK, Rogozin IB, Glazko GV, Koonin EV</span> (2003) Origin of a substantial fraction of human regulatory sequences from transposable elements. Trends Genet 19: 68–72. <a class="find" href="/article/findArticle.action?author=Jordan&title=Origin of a substantial fraction of human regulatory sequences from transposable elements."> Find this article online </a></li><li xpathLocation="noSelect"><a name="pgen-0030107-b027" id="pgen-0030107-b027"></a><span class="authors">Malik HS, Henikoff S</span> (2005) Positive selection of <i>Iris,</i> a retroviral envelope-derived host gene in <span class="genus-species">Drosophila melanogaster</span>. PLoS Genet 1: e44. <a class="find" href="/article/findArticle.action?author=Malik&title=Positive selection of Iris, a retroviral envelope-derived host gene in Drosophila melanogaster."> Find this article online </a></li><li xpathLocation="noSelect"><a name="pgen-0030107-b028" id="pgen-0030107-b028"></a><span class="authors">Britten RJ</span> (2004) Coding sequences of functioning human genes derived entirely from mobile element sequences. Proc Natl Acad Sci 101: 16825–16830. <a class="find" href="/article/findArticle.action?author=Britten&title=Coding sequences of functioning human genes derived entirely from mobile element sequences."> Find this article online </a></li><li xpathLocation="noSelect"><a name="pgen-0030107-b029" id="pgen-0030107-b029"></a><span class="authors">Nekrutenko A, Li WH</span> (2001) Transposable elements are found in a large number of human protein-coding genes. Trends Genet 17: 619–621. <a class="find" href="/article/findArticle.action?author=Nekrutenko&title=Transposable elements are found in a large number of human protein-coding genes."> Find this article online </a></li><li xpathLocation="noSelect"><a name="pgen-0030107-b030" id="pgen-0030107-b030"></a><span class="authors">Aminetzach YT, Macpherson JM, Petrov DA</span> (2005) Pesticide resistance via transposition-mediated adaptive gene truncation in <i>Drosophila</i>. Science 309: 764–767. <a class="find" href="/article/findArticle.action?author=Aminetzach&title=Pesticide resistance via transposition-mediated adaptive gene truncation in Drosophila."> Find this article online </a></li><li xpathLocation="noSelect"><a name="pgen-0030107-b031" id="pgen-0030107-b031"></a><span class="authors">Gray YH</span> (2000) It takes two transposons to tango: Transposable-element-mediated chromosomal rearrangements. Trends Genet 16: 461–468. <a class="find" href="/article/findArticle.action?author=Gray&title=It takes two transposons to tango: Transposable-element-mediated chromosomal rearrangements."> Find this article online </a></li><li xpathLocation="noSelect"><a name="pgen-0030107-b032" id="pgen-0030107-b032"></a><span class="authors">Rubin GM, Yandell MD, Wortman JR, Gabor Miklos GL, Nelson CR, et al. </span> (2000) Comparative genomics of the eukaryotes. Science 287: 2204–2215. <a class="find" href="/article/findArticle.action?author=Rubin&title=Comparative genomics of the eukaryotes."> Find this article online </a></li><li xpathLocation="noSelect"><a name="pgen-0030107-b033" id="pgen-0030107-b033"></a><span class="authors">Wang W, Brunet FG, Nevo E, Long M</span> (2002) Origin of <i>sphinx,</i> a young chimeric RNA gene in <span class="genus-species">Drosophila melanogaster</span>. Proc Natl Acad Sci U S A 99: 4448–4453. <a class="find" href="/article/findArticle.action?author=Wang&title=Origin of sphinx, a young chimeric RNA gene in Drosophila melanogaster."> Find this article online </a></li><li xpathLocation="noSelect"><a name="pgen-0030107-b034" id="pgen-0030107-b034"></a><span class="authors">Betran E, Long M</span> (2003) <i>Dntf-2r,</i> a young <i>Drosophila</i> retroposed gene with specific male expression under positive Darwinian selection. Genetics 164: 977–988. <a class="find" href="/article/findArticle.action?author=Betran&title=Dntf-2r, a young Drosophila retroposed gene with specific male expression under positive Darwinian selection."> Find this article online </a></li><li xpathLocation="noSelect"><a name="pgen-0030107-b035" id="pgen-0030107-b035"></a><span class="authors">Wang W, Yu H, Long M</span> (2004) Duplication-degeneration as a mechanism of gene fission and the origin of new genes in <i>Drosophila</i> species. Nat Genet 36: 523–527. <a class="find" href="/article/findArticle.action?author=Wang&title=Duplication-degeneration as a mechanism of gene fission and the origin of new genes in Drosophila species."> Find this article online </a></li><li xpathLocation="noSelect"><a name="pgen-0030107-b036" id="pgen-0030107-b036"></a><span class="authors">Adams M, Celniker S, Holt R, Evans C, Gocayne J, et al. </span> (2000) The genome sequence of <span class="genus-species">Drosophila melanogaster</span>. Science 287: 2185–2195. <a class="find" href="/article/findArticle.action?author=Adams&title=The genome sequence of Drosophila melanogaster."> Find this article online </a></li><li xpathLocation="noSelect"><a name="pgen-0030107-b037" id="pgen-0030107-b037"></a><span class="authors">Quesneville H, Bergman CM, Andrieu O, Autard D, Nouaud D, et al. </span> (2005) Combined evidence annotation of transposable elements in genome sequence. PLoS Comput Biol 1: e22. <a class="find" href="/article/findArticle.action?author=Quesneville&title=Combined evidence annotation of transposable elements in genome sequence."> Find this article online </a></li><li xpathLocation="noSelect"><a name="pgen-0030107-b038" id="pgen-0030107-b038"></a><span class="authors">Kapitonov VV, Jurka J</span> (2003) Molecular paleontology of transposable elements in the <i>Drosophila melanogaster</i> genome. Proc Natl Acad Sci 100: 6569–6574. <a class="find" href="/article/findArticle.action?author=Kapitonov&title=Molecular paleontology of transposable elements in the Drosophila melanogaster genome."> Find this article online </a></li><li xpathLocation="noSelect"><a name="pgen-0030107-b039" id="pgen-0030107-b039"></a><span class="authors">Singh ND, Petrov DA</span> (2004) Rapid sequence turnover at an intergenic locus in <i>Drosophila</i>. Mol Biol Evol 21: 670–680. <a class="find" href="/article/findArticle.action?author=Singh&title=Rapid sequence turnover at an intergenic locus in Drosophila."> Find this article online </a></li><li xpathLocation="noSelect"><a name="pgen-0030107-b040" id="pgen-0030107-b040"></a><span class="authors">Yang HP, Hung TL, You TL, Yang TH</span> (2006) Genome-wide comparative analysis of the highly abundant transposable element <i>DINE-1</i> suggests a recent transpositional burst in <span class="genus-species">Drosophila yakuba</span>. Genetics 173: 189–196. <a class="find" href="/article/findArticle.action?author=Yang&title=Genome-wide comparative analysis of the highly abundant transposable element DINE-1 suggests a recent transpositional burst in Drosophila yakuba."> Find this article online </a></li><li xpathLocation="noSelect"><a name="pgen-0030107-b041" id="pgen-0030107-b041"></a><span class="authors">Li YJ, Satta Y, Takahata N</span> (1999) Paleo-demography of the <span class="genus-species">Drosophila melanogaster</span> subgroup: Application of the maximum likelihood method. Genes Genet Syst 74: 117–127. <a class="find" href="/article/findArticle.action?author=Li&title=Paleo-demography of the Drosophila melanogaster subgroup: Application of the maximum likelihood method."> Find this article online </a></li><li xpathLocation="noSelect"><a name="pgen-0030107-b042" id="pgen-0030107-b042"></a><span class="authors">Tamura K, Subramanian S, Kumar S</span> (2004) Temporal patterns of fruit fly <i>(Drosophila)</i> evolution revealed by mutation clocks. Mol Biol Evol 21: 36–44. <a class="find" href="/article/findArticle.action?author=Tamura&title=Temporal patterns of fruit fly (Drosophila) evolution revealed by mutation clocks."> Find this article online </a></li><li xpathLocation="noSelect"><a name="pgen-0030107-b043" id="pgen-0030107-b043"></a><span class="authors">Ohler U, Liao GC, Niemann H, Rubin G</span> (2002) Computational analysis of core promoters in the <i>Drosophila</i> genome. Genome Biol 3: research0087.0081–research0087.0012. <a class="find" href="/article/findArticle.action?author=Ohler&title=Computational analysis of core promoters in the Drosophila genome."> Find this article online </a></li><li xpathLocation="noSelect"><a name="pgen-0030107-b044" id="pgen-0030107-b044"></a><span class="authors">Yasuhara JC, DeCrease CH, Wakimoto BT</span> (2005) Evolution of heterochromatic genes of <i>Drosophila</i>. Proc Natl Acad Sci U S A 102: 10958–10963. <a class="find" href="/article/findArticle.action?author=Yasuhara&title=Evolution of heterochromatic genes of Drosophila."> Find this article online </a></li><li xpathLocation="noSelect"><a name="pgen-0030107-b045" id="pgen-0030107-b045"></a><span class="authors">Andolfatto P</span> (2001) Contrasting patterns of X-linked and autosomal nucleotide variation in <span class="genus-species">Drosophila melanogaster</span> and <span class="genus-species">Drosophila simulans</span>. Mol Biol Evol 18: 279–290. <a class="find" href="/article/findArticle.action?author=Andolfatto&title=Contrasting patterns of X-linked and autosomal nucleotide variation in Drosophila melanogaster and Drosophila simulans."> Find this article online </a></li><li xpathLocation="noSelect"><a name="pgen-0030107-b046" id="pgen-0030107-b046"></a><span class="authors">Bachtrog D, Thornton K, Clark A, Andolfatto P</span> (2006) Extensive introgression of mitochondrial DNA relative to nuclear genes in the <span class="genus-species">Drosophila yakuba</span> species group. Evolution Int J Org Evolution 60: 292–302. <a class="find" href="/article/findArticle.action?author=Bachtrog&title=Extensive introgression of mitochondrial DNA relative to nuclear genes in the Drosophila yakuba species group."> Find this article online </a></li><li xpathLocation="noSelect"><a name="pgen-0030107-b047" id="pgen-0030107-b047"></a><span class="authors">McDonald JH, Kreitman M</span> (1991) Adaptative protein evolution at the <i>Adh</i> locus in <i>Drosophila</i>. Nature 351: 652–654. <a class="find" href="/article/findArticle.action?author=McDonald&title=Adaptative protein evolution at the Adh locus in Drosophila."> Find this article online </a></li><li xpathLocation="noSelect"><a name="pgen-0030107-b048" id="pgen-0030107-b048"></a><span class="authors">Presgraves DC</span> (2005) Evolutionary genomics: New genes for new jobs. Curr Biol 15: R52–R53. <a class="find" href="/article/findArticle.action?author=Presgraves&title=Evolutionary genomics: New genes for new jobs."> Find this article online </a></li><li xpathLocation="noSelect"><a name="pgen-0030107-b049" id="pgen-0030107-b049"></a><span class="authors">Nurminsky DI, Nurminskaya MV, De Aguiar D, Hartl DL</span> (1998) Selective sweep of a newly evolved sperm-specific gene in <i>Drosophila</i>. Nature 396: 572–575. <a class="find" href="/article/findArticle.action?author=Nurminsky&title=Selective sweep of a newly evolved sperm-specific gene in Drosophila."> Find this article online </a></li><li xpathLocation="noSelect"><a name="pgen-0030107-b050" id="pgen-0030107-b050"></a><span class="authors">Loppin B, Lepetit D, Dorus S, Couble P, Karr TL</span> (2005) Origin and neofunctionalization of a <i>Drosophila</i> paternal effect gene essential for zygote viability. Curr Biol 15: 87–93. <a class="find" href="/article/findArticle.action?author=Loppin&title=Origin and neofunctionalization of a Drosophila paternal effect gene essential for zygote viability."> Find this article online </a></li><li xpathLocation="noSelect"><a name="pgen-0030107-b051" id="pgen-0030107-b051"></a><span class="authors">Jones CD, Custer AW, Begun DJ</span> (2005) Origin and evolution of a chimeric fusion gene in <i>Drosophila subobscura, D. madeirensis</i> and <span class="genus-species">D. guanche</span>. Genetics 170: 207–219. <a class="find" href="/article/findArticle.action?author=Jones&title=Origin and evolution of a chimeric fusion gene in Drosophila subobscura, D. madeirensis and D. guanche."> Find this article online </a></li><li xpathLocation="noSelect"><a name="pgen-0030107-b052" id="pgen-0030107-b052"></a><span class="authors">Arguello JR, Chen Y, Yang S, Wang W, Long M</span> (2006) Origination of an X-linked testes chimeric gene by illegitimate recombination in <i>Drosophila</i>. PLoS Genet 2: e77. <a class="find" href="/article/findArticle.action?author=Arguello&title=Origination of an X-linked testes chimeric gene by illegitimate recombination in Drosophila."> Find this article online </a></li><li xpathLocation="noSelect"><a name="pgen-0030107-b053" id="pgen-0030107-b053"></a><span class="authors">Lifschytz E, Lindsley DL</span> (1972) The role of X-chromosome inactivation during spermatogenesis. Proc Natl Acad Sci U S A 69: 182–186. <a class="find" href="/article/findArticle.action?author=Lifschytz&title=The role of X-chromosome inactivation during spermatogenesis."> Find this article online </a></li><li xpathLocation="noSelect"><a name="pgen-0030107-b054" id="pgen-0030107-b054"></a><span class="authors">Parisi M</span> (2003) Paucity of genes on the <i>Drosophila</i> X chromosome showing male-biased expression. Science 299: 697–700. <a class="find" href="/article/findArticle.action?author=Parisi&title=Paucity of genes on the Drosophila X chromosome showing male-biased expression."> Find this article online </a></li><li xpathLocation="noSelect"><a name="pgen-0030107-b055" id="pgen-0030107-b055"></a><span class="authors">Ranz JM, Castillo-Davis CI, Meiklejohn CD, Hartl DL</span> (2003) Sex-dependent gene expression and evolution of the <i>Drosophila</i> transcriptome. Science 300: 1742–1745. <a class="find" href="/article/findArticle.action?author=Ranz&title=Sex-dependent gene expression and evolution of the Drosophila transcriptome."> Find this article online </a></li><li xpathLocation="noSelect"><a name="pgen-0030107-b056" id="pgen-0030107-b056"></a><span class="authors">Zhang Z, Hambuch TM, Parsch J</span> (2004) Molecular evolution of sex-biased genes in <i>Drosophila</i>. Mol Biol Evol 21: 2130–2139. <a class="find" href="/article/findArticle.action?author=Zhang&title=Molecular evolution of sex-biased genes in Drosophila."> Find this article online </a></li><li xpathLocation="noSelect"><a name="pgen-0030107-b057" id="pgen-0030107-b057"></a><span class="authors">Jagadeeshan S, Singh RS</span> (2005) Rapidly evolving genes of <i>Drosophila:</i> Differing levels of selective pressure in testis, ovary, and head tissues between sibling species. Mol Biol Evol 22: 1793–1801. <a class="find" href="/article/findArticle.action?author=Jagadeeshan&title=Rapidly evolving genes of Drosophila: Differing levels of selective pressure in testis, ovary, and head tissues between sibling species."> Find this article online </a></li><li xpathLocation="noSelect"><a name="pgen-0030107-b058" id="pgen-0030107-b058"></a><span class="authors">Caceres M, Ranz JM, Barbadilla A, Long M, Ruiz A</span> (1999) Generation of a widespread <i>Drosophila</i> inversion by a transposable element. Science 285: 415–418. <a class="find" href="/article/findArticle.action?author=Caceres&title=Generation of a widespread Drosophila inversion by a transposable element."> Find this article online </a></li><li xpathLocation="noSelect"><a name="pgen-0030107-b059" id="pgen-0030107-b059"></a><span class="authors">Kim JM, Vanguri S, Boeke JD, Gabriel A, Voytas DF</span> (1998) Transposable elements and genome organization: A comprehensive survey of retrotransposons revealed by the complete <span class="genus-species">Saccharomyces cerevisiae</span> genome sequence. Genome Res 8: 464–478. <a class="find" href="/article/findArticle.action?author=Kim&title=Transposable elements and genome organization: A comprehensive survey of retrotransposons revealed by the complete Saccharomyces cerevisiae genome sequence."> Find this article online </a></li><li xpathLocation="noSelect"><a name="pgen-0030107-b060" id="pgen-0030107-b060"></a><span class="authors">Kellis M, Birren BW, Lander ES</span> (2004) Proof and evolutionary analysis of ancient genome duplication in the yeast <span class="genus-species">Saccharomyces cerevisiae</span>. Nature 428: 617–624. <a class="find" href="/article/findArticle.action?author=Kellis&title=Proof and evolutionary analysis of ancient genome duplication in the yeast Saccharomyces cerevisiae."> Find this article online </a></li><li xpathLocation="noSelect"><a name="pgen-0030107-b061" id="pgen-0030107-b061"></a><span class="authors">Patel N</span> (1996) In situ hybridization to whole-mount <i>Drosophila</i> embryos. In: Krieg P, editor. A laboratory guide to RNA: Isolation, analysis, and synthesis. New York: Wiley-Liss, Inc. pp. 357–369. </li><li xpathLocation="noSelect"><a name="pgen-0030107-b062" id="pgen-0030107-b062"></a><span class="authors">Thompson JD, Higgins DG, Gibson TJ</span> (1994) CLUSTAL W: Improving the sensitivity of progressive multiple sequence alignment through sequence weighting, positions-specific gap penalties and weight matrix choice. Nucleic Acids Res 22: 4673–4680. <a class="find" href="/article/findArticle.action?author=Thompson&title=CLUSTAL W: Improving the sensitivity of progressive multiple sequence alignment through sequence weighting, positions-specific gap penalties and weight matrix choice."> Find this article online </a></li><li xpathLocation="noSelect"><a name="pgen-0030107-b063" id="pgen-0030107-b063"></a><span class="authors">Kumar S, Tamura K, Nei M</span> (2004) MEGA 3: Integrated software for molecular evolutionary genetics analysis and sequence alignment. Brief Bioinform 5: 150–163. <a class="find" href="/article/findArticle.action?author=Kumar&title=MEGA 3: Integrated software for molecular evolutionary genetics analysis and sequence alignment."> Find this article online </a></li><li xpathLocation="noSelect"><a name="pgen-0030107-b064" id="pgen-0030107-b064"></a><span class="authors">Rozas J, Rozas R</span> (1999) DnaSP version 3: An integrated program for molecular population genetics and molecular evolution analysis. Bioinformatics 15: 174–175. <a class="find" href="/article/findArticle.action?author=Rozas&title=DnaSP version 3: An integrated program for molecular population genetics and molecular evolution analysis."> Find this article online </a></li></ol></div> </div> </div> <div style="display:none"> <div dojoType="ambra.widget.RegionalDialog" id="AnnotationDialog" style="padding:0;margin:0;"> <div class="dialog annotate"> <div class="tipu" id="dTipu"></div> <div class="comment"> <h5><span class="commentPrivate">Add Your Note (For Private Viewing)</span><span class="commentPublic">Post Your Note (For Public Viewing)</span></h5> <div class="posting pane"> <form name="createAnnotation" id="createAnnotation" method="post" action=""> <input type="hidden" name="target" value="info:doi/10.1371/journal.pgen.0030107" /> <input type="hidden" name="startPath" value="" /> <input type="hidden" name="startOffset" value="" /> <input type="hidden" name="endPath" value="" /> <input type="hidden" name="endOffset" value="" /> <input type="hidden" name="commentTitle" id="commentTitle" value="" /> <input type="hidden" name="comment" id="commentArea" value="" /> <input type="hidden" name="ciStatement" id="statementArea" value="" /> <input type="hidden" name="isCompetingInterest" id="isCompetingInterest" value="false" /> <input type="hidden" name="noteType" id="noteType" value="" /> <fieldset> <legend>Compose Your Note</legend> <span id="submitMsg" class="error" style="display:none;"></span> <table class="layout"> <tr> <td> <label for="cNoteType">This is a </label><select name="cNoteType" id="cNoteType"><option value="note">note</option><option value="correction">correction</option></select> <span id="cdls" style="visibility:hidden;margin-left:0.3em; white-space:nowrap;"><a href="/static/commentGuidelines.action?target=info%3Adoi%2F10.1371%2Fjournal.pgen.0030107#corrections">What are corrections?</a></span> <label for="cTitle" class="commentPublic"><span class="none">Enter your note title</span><!-- error message text <em>A title is required for all public notes</em>--></label> <input type="text" name="cTitle" id="cTitle" value="Enter your note title..." class="title commentPublic" alt="Enter your note title..." /> <label for="cArea"><span class="none">Enter your note</span><!-- error message text <em>Please enter your note</em>--></label> <textarea name="cArea" id="cArea" value="Enter your note..." alt="Enter your note...">Enter your note...</textarea> <input type="hidden" name="isPublic" value="true" /> </td> <td> </td> <td class="coi"> <fieldset> <legend>Declare any competing interests.</legend> <ul> <li><label><input id="isCompetingInterestNo" type="radio" checked="checked" name="competingInterest" value="false" /> No, I don't have any competing interests to declare.</label></li> <li><label><input id="isCompetingInterestYes" type="radio" name="competingInterest" value="true" /> Yes, I have competing interests to declare (enter below):</label></li> </ul> <textarea name="ciStatementArea" id="ciStatementArea" disabled value="Enter your competing interests..." alt="Enter your competing interests...">Enter your competing interests...</textarea> </fieldset> </td> </tr> <tr> <td colspan="3" class="buttons"> <input type="button" value="Cancel" title="Click to close and cancel" id="btn_cancel"/> <input type="button" value="Submit" title="Click to post your note publicly" id="btn_post" class="primary"/> </td> </tr> </table> </fieldset> </form> </div> </div> <div class="tip" id="dTip"></div> </div> </div><div dojoType="ambra.widget.ContextAction" id="ContextActionDialog" class="contextActionDialog"> <div class="dialog context"> <div class="tipu" id="caTipu"></div> <div class="contextActionContent"> <h5><img src="/images/tooltip_addannotation.gif" /> Add a note to this text.</h5> Please follow our <a href="/static/commentGuidelines.action">guidelines for notes and comments</a> and review our <a href="/static/competing.action">competing interests policy</a>. Comments that do not conform to our guidelines will be promptly removed and the user account disabled. The following must be avoided: <ul> <li>Remarks that could be interpreted as allegations of misconduct</li> <li>Unsupported assertions or statements</li> <li>Inflammatory or insulting language</li> </ul> <form name="contextActionForm" id="contextActionForm" class="clearfix buttons" method="post" action=""> <input type="button" name="Continue" value="Continue" id="ContextActionDialogContinueButton" onmouseup="ambra.displayAnnotationContext.startComment(event);" title="Add a note to this text" class="primary"/> <input type="button" name="Cancel" value="Cancel" id="ContextActionDialogCancelButton" onclick="return false;" onmouseup="ambra.displayAnnotationContext.cancelContext(event);" title="Close this Window"/> </form> </div> <div class="tip" id="caTip"></div> </div> </div> <div dojoType="ambra.widget.ContextAction" id="ContextActionDialogNotLogged" class="contextActionDialog"> <div class="dialog context"> <div class="tipu" id="canlTipu"></div> <div class="contextActionContent"> <h5><img src="/images/tooltip_addannotation.gif" /> Add a note to this text.</h5> You must be logged in to add a note to an article. You may log in by <a onmousedown="ambra.displayAnnotationContext.disconnect(event);" href="/user/secure/secureRedirect.action?goTo=%2Farticle%2Finfo%3Adoi%2F10.1371%2Fjournal.pgen.0030107">clicking here</a> or <a href="#" onclick="return false;" onmouseup="ambra.displayAnnotationContext.cancelContext(event);">cancel this note</a>. </div> <div class="tip" id="canlTip"></div> </div> </div> <div dojoType="ambra.widget.ContextAction" id="ContextActionDialogBadSelection" class="contextActionDialog"> <div class="dialog context"> <div class="tipu" id="canBDTipu"></div> <div class="contextActionContent"> <h5 class="annotation icon"><img src="/images/tooltip_addannotation.gif" /> Add a note to this text.</h5> You cannot annotate this area of the document. <a href="#" onclick="return false;" onmouseup="ambra.displayAnnotationContext.cancelContext(event);">Close</a> </div> <div class="tip" id="canBDTip"></div> </div> </div> <div dojoType="ambra.widget.ContextAction" id="ContextActionDialogBadRangeSelection" class="contextActionDialog"> <div class="dialog context"> <div class="tipu" id="canbrTipu"></div> <div class="contextActionContent"> <h5><img src="/images/tooltip_addannotation.gif" /> Add a note to this text.</h5> You cannot create an annotation that spans different sections of the document; please adjust your selection.<br/> <a href="#" onclick="return false;" onmouseup="ambra.displayAnnotationContext.cancelContext(event);">Close</a> </div> <div class="tip" id="canbrTip"></div> </div> </div> <div dojoType="ambra.widget.RegionalDialog" id="CommentDialog" style="padding:0;margin:0;"> <div class="dialog preview"> <div class="tipu" id="cTipu"></div> <div class="btn close" id="btn_close" title="Click to close"><a title="Click to close">Close</a></div> <div id="cmtContainer" class="comment"> <h6 id="viewCmtTitle"></h6> <div class="detail" id="viewCmtDetail"></div> <div class="contentwrap" id="viewComment"></div> <div class="contentwrap" id="viewCIStatement"></div> <div class="detail" id="viewLink"> <!--<a href="#" class="commentary icon" title="Click to view full thread and respond">View all responses</a> <a href="#" class="respond tooltip" title="Click to respond to this posting">Respond to this</a>--> </div> </div> <div class="tip" id="cTip"></div> </div> </div> <div dojoType="ambra.widget.RegionalDialog" id="CommentDialogMultiple" style="padding:0;margin:0;"> <div class="dialog multiple preview"> <div class="tipu" id="mTipu"></div> <div class="btn close" id="btn_close_multi" title="Click to close"><a title="Click to close">Close</a></div> <ol id="multilist"></ol> <br/> <div id="multidetail"></div> <div class="tip" id="mTip"></div> </div> </div> <div dojoType="dijit.Dialog" id="Rating"> <div class="dialog annotate"> <div class="tipu" id="dTipu"></div> <div class="comment"> <h5><span class="commentPublic">Rate This Article</span></h5> <div class="instructions">Please follow our <a href="/static/ratingGuidelines.action">guidelines for rating</a> and review our <a href="/static/competing.action">competing interests policy</a>. Comments that do not conform to our guidelines will be promptly removed and the user account disabled. The following must be avoided: <ol> <li>Remarks that could be interpreted as allegations of misconduct</li> <li>Unsupported assertions or statements</li> <li>Inflammatory or insulting language</li> </ol> </div> <div class="posting pane"> <form name="ratingForm" id="ratingForm" method="post" action=""> <input type="hidden" name="articleURI" value="info:doi/10.1371/journal.pgen.0030107" /> <input type="hidden" name="commentTitle" id="commentTitle" value="" /> <input type="hidden" name="comment" id="commentArea" value="" /> <input type="hidden" name="ciStatement" id="statementArea" value="" /> <input type="hidden" name="isCompetingInterest" id="isCompetingInterest" value="" /> <fieldset> <legend>Compose Your Annotation</legend> <span id="submitRatingMsg" class="error" style="display:none;"></span> <table class="layout"> <tr> <td rowspan="2"> <label for="insight">Insight</label> <ul class="star-rating rating edit" title="Rate insight" id="rateInsight"> <li class="current-rating pct0"></li> <li><a href="javascript:void(0);" title="Bland" class="one-star" onclick="ambra.rating.setRatingCategory(this, 'insight', 1);">1</a></li> <li><a href="javascript:void(0);" title="" class="two-stars" onclick="ambra.rating.setRatingCategory(this, 'insight', 2);">2</a></li> <li><a href="javascript:void(0);" title="" class="three-stars" onclick="ambra.rating.setRatingCategory(this, 'insight', 3);">3</a></li> <li><a href="javascript:void(0);" title="" class="four-stars" onclick="ambra.rating.setRatingCategory(this, 'insight', 4);">4</a></li> <li><a href="javascript:void(0);" title="Profound" class="five-stars" onclick="ambra.rating.setRatingCategory(this, 'insight', 5);">5</a></li> </ul> <input type="hidden" name="insight" title="insight" value="" /> <label for="reliability">Reliability</label> <ul class="star-rating rating edit" title="Rate reliability" id="rateReliability"> <li class="current-rating pct0"></li> <li><a href="javascript:void(0);" title="Tenuous" class="one-star" onclick="ambra.rating.setRatingCategory(this, 'reliability', 1);">1</a></li> <li><a href="javascript:void(0);" title="" class="two-stars" onclick="ambra.rating.setRatingCategory(this, 'reliability', 2);">2</a></li> <li><a href="javascript:void(0);" title="" class="three-stars" onclick="ambra.rating.setRatingCategory(this, 'reliability', 3);">3</a></li> <li><a href="javascript:void(0);" title="" class="four-stars" onclick="ambra.rating.setRatingCategory(this, 'reliability', 4);">4</a></li> <li><a href="javascript:void(0);" title="Unassailable" class="five-stars" onclick="ambra.rating.setRatingCategory(this, 'reliability', 5);">5</a></li> </ul> <input type="hidden" name="reliability" title="reliability" value="" /> <label for="style">Style</label> <ul class="star-rating rating edit" title="Rate style" id="rateStyle"> <li class="current-rating pct0"></li> <li><a href="javascript:void(0);" title="Crude" class="one-star" onclick="ambra.rating.setRatingCategory(this, 'style', 1);">1</a></li> <li><a href="javascript:void(0);" title="" class="two-stars" onclick="ambra.rating.setRatingCategory(this, 'style', 2);">2</a></li> <li><a href="javascript:void(0);" title="" class="three-stars" onclick="ambra.rating.setRatingCategory(this, 'style', 3);">3</a></li> <li><a href="javascript:void(0);" title="" class="four-stars" onclick="ambra.rating.setRatingCategory(this, 'style', 4);">4</a></li> <li><a href="javascript:void(0);" title="Elegant" class="five-stars" onclick="ambra.rating.setRatingCategory(this, 'style', 5);">5</a></li> </ul> <input type="hidden" name="style" title="style" value="" /> <label for="cTitle" class="commentPublic"><span class="none">Enter your comment title</span><!-- error message text <em>A title is required for all public annotations</em>--></label> <input type="text" name="cTitle" id="cTitle" value="Enter your comment title..." class="title commentPublic" alt="Enter your comment title..." /> <label for="cArea"><span class="none">Enter your comment</span><!-- error message text <em>Please enter your annotation</em>--></label> <textarea name="cArea" id="cArea" value="Enter your comment..." alt="Enter your comment...">Enter your comment...</textarea> </td> <td rowspan="2"> </td> <td class="coi"> <fieldset> <legend>Declare any competing interests.</legend> <ul> <li><label><input id="isCompetingInterestNo" type="radio" name="competingInterest" value="false" /> No, I don't have any competing interests to declare.</label></li> <li><label><input id="isCompetingInterestYes" type="radio" name="competingInterest" value="true" /> Yes, I have competing interests to declare (enter below):</label></li> </ul> <textarea name="ciStatementArea" id="ciStatementArea" disabled value="Enter your competing interests..." title="Enter your competing interests...">Enter your competing interests...</textarea> </fieldset> </td> </tr> <tr> <td class="buttons"> <input type="button" value="Cancel" title="Click to close and cancel" id="btn_cancel_rating"/> <input type="button" value="Submit" title="Click to post your annotation publicly" id="btn_post_rating" class="primary"/> </td> </tr> </table> </fieldset> </form> </div> </div> </div> </div> <div dojoType="ambra.widget.LoadingCycle" id="LoadingCycle" class="loadingCycler"> <img src="/images/loading.gif" width="58" height="58" title="Loading..." /> </div> </div> </div> <!-- end : main contents --> </div> <!-- end : container --> <!-- begin : footer --> <div id="ftr"> <p><span>All site content, except where otherwise noted, is licensed under a <a href="http://creativecommons.org/licenses/by/2.5/" title="Creative Commons Attribution License 2.5" tabindex="200">Creative Commons Attribution License</a>.</span></p> <ul> <li><a href="/static/privacy.action" title="PLoS Privacy Statement" tabindex="501">Privacy Statement</a></li> <li><a href="/static/terms.action" title="PLoS Terms of Use" tabindex="502">Terms of Use</a></li> <li><a href="http://www.plos.org/advertise/" title="Advertise With PLoS" tabindex="503">Advertise</a></li> <li><a href="http://www.plos.org/journals/embargopolicy.html" title="PLoS Embargo Policy" tabindex="504">Media Inquiries</a></li> <li><a href="http://www.plos.org/journals/print.html" title="PLoS in Print" tabindex="505">PLoS in Print</a></li> <li><a href="/static/sitemap.action" title="Site Map" tabindex="506">Site Map</a></li> <li><a href="http://www.plos.org" title="PLoS.org" tabindex="507">PLoS.org</a></li> </ul> <div class="powered"> <ul> <li><a href="/static/releaseNotes.action" title="Ambra | Release Notes">Ambra 0.9.4 beta</a></li> <li>Managed Colocation provided by <a href="http://www.unitedlayer.com/" title="UnitedLayer: Built on IP Services">UnitedLayer</a>.</li> </ul> </div> </div> <!-- end : footer --> <script type="text/javascript"> var _namespace=""; var loggedIn = false; var almHost = "http://alm.plos.org"; // Safari v3.1.1 "console.debug" issue (http://trac.dojotoolkit.org/ticket/6849) workaround if (/3[\.0-9]+ Safari/.test(navigator.appVersion)) { window.console = { origConsole: window.console, log: function(s){ this.origConsole.log(s); }, info: function(s){ this.origConsole.info(s); }, error: function(s){ this.origConsole.error(s); }, warn: function(s){ this.origConsole.warn(s); } }; } var djConfig = { // don't debug for IE - as dojo's firebug lite module is error prone in IE isDebug: false, parseOnLoad: true }; </script> <script type="text/javascript" src="/javascript/dojo/dojo/dojo.js"></script> <script type="text/javascript" src="/javascript/dojo/dojo/ambra.js"></script> <script type="text/javascript" src="/javascript/init_global.js"></script> <script type="text/javascript" src="/javascript/init_article.js"></script> <script type="text/javascript" src="/javascript/init_ratings.js"></script> <script type="text/javascript" src="/javascript/init_article_body.js"></script> <script type="text/javascript" src="/javascript/init_article_rhc.js"></script> <script type="text/javascript" src="/javascript/alm.js"></script> <script type="text/javascript" src="/javascript/reporting/articleViewsCumulative.js"></script> <script type="text/javascript"> var gaJsHost = (("https:" == document.location.protocol) ? "https://ssl." : "http://www."); document.write(unescape("%3Cscript src='" + gaJsHost + "google-analytics.com/ga.js' type='text/javascript'%3E%3C/script%3E")); </script> <script type="text/javascript"> var pageTracker = _gat._getTracker("UA-338393-1"); pageTracker._trackPageview(); pageTracker._setDomainName("www.plosgenetics.org"); </script> </body> </html>