- Download: PDF | Citation | XML
- Print article
- EzReprint New & improved!
Published in the June 2008 Issue of PLoS Genetics
Open Access
Research Article
Overlapping Protein-Encoding Genes in Pseudomonas fluorescens Pf0-1
- To add a note, highlight some text. Hide notes
- Make a general comment
Center for Adaptation Genetics and Drug Resistance, Department of Molecular Biology and Microbiology, Tufts University School of Medicine, Boston, Massachusetts, United States of America
Abstract Top
The annotated genome sequences of prokaryotes seldom include overlapping genes encoded opposite each other by the same stretch of DNA. However, antisense transcription is becoming recognized as a widespread phenomenon in eukaryotes, and examples have been linked to important biological processes. Pseudomonas fluorescens inhabits aquatic and terrestrial environments, and can be regarded as an environmental generalist. The genetic basis for this ecological success is not well understood. In a previous search for soil-induced genes in P. fluorescens Pf0-1, ten antisense genes were discovered. These were termed ‘cryptic’ genes, as they had escaped detection by gene-hunting algorithms, and lacked easily recognizable promoters. In this communication, we designate such genes as ‘non-predicted’ or ‘hidden’. Using reverse transcription PCR, we show that at each of six non-predicted gene loci chosen for study, transcription occurs from both ‘sense’ and ‘antisense’ DNA strands. Further, at least one of these hidden antisense genes, iiv14, encodes a protein, as does the sense transcript, both identified by poly-histidine tags on the C-terminus of the proteins. Mutational and complementation studies showed that this novel antisense gene was important for efficient colonization of soil, and multiple copies in the wildtype host improved the speed of soil colonization. Introduction of a stop codon early in the gene eliminated complementation, further implicating the protein in colonization of soil. We therefore designate iiv14 “cosA”. These data suggest that, as is the case with eukaryotes, some bacterial genomes are more densely coded than currently recognized.
Author Summary Top
Sequenced bacterial genomes provide a vast resource for research fields such as pathogenesis, drug discovery, and microbial ecology. Once sequenced, the genes within a genome are predicted using computational and manual methods. An assumption underlying both approaches is that any given length of DNA encodes only a single gene. This concept has been challenged by findings in eukaryotic genomes, and in bacterial plasmids and viruses where it is known that some stretches of DNA specify both ‘sense’ and ‘antisense’ RNA molecules. In prokaryotic cells there is little information regarding the potential of the genome to code two genes within the same stretch of DNA. We show that in the bacterium Pseudomonas fluorescens Pf0-1, both strands of DNA are transcribed at six locations in the genome, and that at one of these locations (iiv14), two different proteins are specified by the same piece of DNA. At the iiv14 locus, we demonstrate that the newly identified gene (antisense to the predicted gene) functions to promote colonization of soil, and name this gene cosA. Our findings indicate that bacterial genomes have more genes than currently thought, and important genes that have escaped detection occupy the same stretch of DNA as known genes.
Citation: Silby MW, Levy SB (2008) Overlapping Protein-Encoding Genes in Pseudomonas fluorescens Pf0-1. PLoS Genet 4(6): e1000094. doi:10.1371/journal.pgen.1000094
Editor: Susan M. Rosenberg, Baylor College of Medicine, United States of America
Received: November 28, 2007; Accepted: May 12, 2008; Published: June 13, 2008
Copyright: © 2008 Silby, Levy. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Funding: This work was supported by USDA grant 2006-35604-16673 to SBL. MWS was supported in part by a postdoctoral fellowship from the New Zealand Foundation for Research Science and Technology.
Competing interests: The authors have declared that no competing interests exist.
* E-mail: Stuart.Levy@tufts.edu
Introduction Top
The genetic basis for ecological success is not well understood, yet has practical and fundamental significance. The environmental versatility of P. fluorescens, coupled with secondary metabolism that enables strains to antagonize plant pathogenic fungi or degrade organic pollutants, makes this species an important and relevant model for investigating environmental fitness and applications such as biocontrol and bioremediation. Furthermore, insight into complex ecosystem interactions is enhanced by knowledge of fitness determinants of the individual players.
To expand the understanding of genes functioning to promote soil fitness, we examined gene activity by evaluating expression when introduced into soil [1]. It has been proposed that elevated gene expression in a particular environment likely contributes to fitness of that organism within that environment [2]. Consistent with this suggestion, several studies have identified niche-specific gene activation and subsequently demonstrated that mutations in some of those genes reduced fitness in the environment in question [3]–[6]. Using in vivo expression technology (IVET) to directly examine gene expression of P. fluorescens Pf0-1 in soil, we identified 22 genes which were up-regulated during growth in soil. Mutations were subsequently introduced into three of these genes, and in each case the mutant showed a defect in soil colonization. Interestingly, ten soil-induced antisense genes were discovered, none of which was predicted by computational annotation of the Pf0-1 genome sequence [1],[7]. These have previously been termed ‘cryptic’ genes as they had escaped detection by gene hunting algorithms [7]. Herein, these are termed ‘hidden’ or ‘non-predicted’ genes.
Although antisense transcription has been reported in eukaryotic systems [8]–[11], antisense genes in prokaryote genomes have received limited attention, usually as antisense RNA regulators [12],[13]. Previous IVET experiments have suggested the existence of additional sense/antisense transcriptional pairs in bacteria [e.g. 3,6], but these suggestions have not been further investigated.
We chose for further study six loci at which non-predicted antisense genes were reported opposite predicted genes. Here we report the confirmation of sense/antisense transcription at each of these six loci. We demonstrate that both the hitherto unknown gene iiv14, and the putative membrane protein gene found opposite, specify proteins. Further, we show that the gene iiv14 is important for colonization of soil, and therefore name the iiv14 gene cosA.
Our analysis of sense/antisense transcripts in P. fluorescens dramatically increases the number of experimentally verified sense/antisense pairs in bacteria. Our data suggest that bacterial genomes are more densely coded than currently known, and that key traits pertaining to microbial ecology can be specified by hidden genes found antisense to those predicted during genome annotation.
Results Top
Predicted Genes and Non-Predicted Antisense Genes in P. fluorescens Pf0-1 Are Transcribed
We previously reported the discovery of ten DNA sequences expressed during growth of P. fluorescens Pf0-1 in soil, that were antisense to predicted genes in the genome of Pf0-1 [1]. These ten antisense sequences are not physically linked to each other, and have no similarity to known protein-coding genes [1]. We carried out RT-PCR experiments at six loci using gene specific primers to generate the cDNA, and thus distinguish transcripts produced from the two DNA strands. In laboratory cultures we detected a basal level of expression from both the predicted coding and antisense sequences (Figure 1A), lower than that required for observable dapB reporter gene activity in the initial IVET screen and for survival on minimal medium [1]. In a control experiment at the rpoS locus, transcription was only detectable from the rpoS gene, not the opposite DNA strand (Figure S1). In all RT-PCR experiments, controls in which reverse transcriptase was omitted produced no products. The direct demonstration of transcription of the non-predicted antisense genes confirms their existence, and transcription of the predicted genes on the opposite strand indicates these are not simply mis-annotated.
Figure 1. Transcription, organization, and translation of annotated and non-predicted antisense genes.
A. RT-PCR, using gene-specific primers, of six pairs of annotated and antisense genes. At each locus, transcription from both DNA strands was detected. In all cases, negative controls which excluded reverse transcriptase from the reactions showed that contaminating DNA was not present. Pfl numbers refer to predicted Pf0-1 genes, (GenBank). The iiv numbers are as described [1]. B. Organization of the iiv14 locus. Solid arrows indicate predicted open reading frames for annotated (Pfl ORFS) and cryptic (iiv14) genes. C. Western blot of purified iiv14-His protein. Lane 1: His-tagged iiv14 protein (arrow). Lane 2: control extract from Pf0-1(pME6000), showing no non-specific detection of untagged proteins. D. Western blot of His-tagged Pfl_0939. Crude extracts were prepared from Pf0-1 with and without Pfl_0939-His. Lane 1: His-tagged Pfl_0939 protein (arrow). Lane 2: extract from Pf0-1(pME6000) showing no non-specific detection of proteins similar in size to Pfl_0939. There is a non-specific background band at 115 kDa in both. Approximate sizes of molecular weight standards (Invitrogen BenchMark Pre-stained Protein Ladder) used in the SDS-PAGE are shown in panels C and D.
doi:10.1371/journal.pgen.1000094.g001Transcriptional Mapping of the Non-Predicted Gene iiv14
The gene iiv14 was chosen for further investigation. The transcribed region of iiv14 identified by RT-PCR is within a potential open reading frame complementary to bases 1092441–1093457 in the Pf0-1 genome sequence, the conceptual translation product of which has no significant matches in GenBank (GenBank accession number CP000094). If the iiv14 transcript spanned the ORF, it would suggest that iiv14 could be translated. The transcription start site was mapped by 5′ RACE to 160 bp upstream of the candidate ORF. RT-PCR experiments with gene-specific primers were used to determine that the 3′ end of the transcribed sequence was at least 210 bp downstream of the presumed stop codon. In addition, the TransTermHP website (http://transterm.cbcb.umd.edu/tt/Pseudomonas_fluorescens_PfO-1.tt) showed a predicted terminator spanning bases 1092229–1092199 of the Pf0-1 genome (starting 193bp downstream of the presumed stop codon), with a confidence score of 41. Thus, the iiv14 transcript is at least 1388 nucleotides long, and the candidate ORF is within the iiv14 transcript (Figure S2).
Both iiv14 and the Predicted Gene Opposite Are Translated
To provide direct evidence for translation of the candidate iiv14 ORF, and the predicted opposite gene (Pfl_0939) (Figure 1B) we added codons for six histidines to the 3′ end of both putative genes, cloned each in plasmid pME6000 (about 15 copies per cell), and transferred these to Pf0-1. Both constructs included the ORF plus upstream sequence likely to contain the native promoter (747 bp for iiv14 and 148 bp for Pfl_0939). Inclusion of the native promoter and expression in Pf0-1 ensured that observed proteins were not artifacts resulting from expression in a heterologous host or under control of a non-native promoter. Western blot analysis using an antibody directed to polyHis demonstrated that both the iiv14 ORF and Pfl_0939 specify proteins, of approximately the expected size (Figure 1C and D). The iiv14 protein was 37 kDa, consistent with the predicted molecular weight (MW) of 38.788 kDa, while the MW of the Pfl_0939 protein was about 70 kDa, slightly less than the expected 80.745 kDa, but not unusual for membrane proteins. Consistent with the fact that iiv14 is upregulated in soil and only expressed at a basal level in laboratory culture, the His-tagged iiv14 protein had to be purified from 1L of culture and concentrated prior to western blot analysis, and films were exposed for 14–16 hours to obtain a clear signal.
The iiv14/Pfl_0939 Locus Is Required for Efficient Soil Colonization
The proposed translation product of iiv14 has no significant matches in BlastP searches of GenBank, providing no functional clues. We therefore sought to examine its importance in a sterile soil growth assay, where its expression is elevated. The iiv14 ORF was deleted by SOE PCR [14] and allele exchange as described [1]. Because iiv14 and Pfl_0939 overlap, the deletion results in a double mutant. Further, deletion of the iiv14 ORF also removes the first 44 bases of Pfl_0940, probably rendering it non-functional. Growth of this deletion mutant in soil was monitored by periodic sampling of colony forming units. The iiv14/0939/0940 mutant was unable to colonize soil as rapidly as Pf0-1 (p<0.001) (Figure 2A, columns 1 and 2). However, between the first and second days when the wild-type had already approached maximum colonization density, the population of the Pf0-1Δiiv14 strain increased 1000 fold (Figure 2A, column 4), such that the cell numbers of both strains were approximately equal after two days of growth. Thus, the iiv14/0939/0940 deletion affected the early part of soil colonization, rather than soil survival per se. In laboratory medium (PMM), both Pf0-1 and the mutant showed approximately equal doubling times (65 min).
Figure 2. Soil colonization experiments.
A. Growth of Pf0-1 wild-type and iiv14 mutant strains (Δiiv14) in sterile soil, inoculated from laboratory culture. Data points represent fold increases from individual experiments, horizontal lines represent median values. 0–1, population increase between inoculation and day 1. The population increase of mutant Δiiv14 is significantly lower than that of Pf0-1 (p<0.001); 1–2, the population increase over the second day. The mutant Δiiv14 recovers from the colonization defect, and increases significantly more than Pf0-1 (p<0.005), which had already neared its maximum. B. Growth of Pf0-1 and the iiv14 mutant in sterile soil, after prior growth in soil. Both strains were grown in separate soil samples for seven days. Populated soil was then mixed with fresh sterile soil to achieve dilution in the range of 1:1000–1:10000, and water was added to achieve approximately 50% water holding capacity. Populations in the fresh soil were monitored as described above. 0–1, population increase between inoculation and day 1. Over this period, Pf0-1 colonized the soil significantly better than the mutant Δiiv14 (p<0.005); 1–2, the population increase over the second day. The increases are not significantly different. Pf0-1 is represented by circles, while the iiv14 mutant is indicated by triangles.
doi:10.1371/journal.pgen.1000094.g002For the soil growth experiments, cells grown in laboratory culture were used as the inoculum. Thus, the slow initial growth of Pf0-1Δiiv14 could potentially be explained by a defect in adapting from laboratory media to soil. We therefore transferred wild-type and iiv14/0939/0940 mutant bacteria which had grown in soil for seven days into fresh soil, by diluting the previously colonized soil with fresh sterile soil. After one day in fresh soil, the increase of the mutant population was significantly (at least 100-fold) lower than that of Pf0-1 (p<0.005), demonstrating that the deletion of the iiv14 locus results in a soil colonization defect, not a defect in adapting to growth in soil after growth in laboratory culture medium (Figure 2B). Over the period between 24 and 48 hours, the iiv14-locus mutant population increased more than the Pf0-1 population, as the latter had already approached its maximum density in the first 24 hours.
Complementation Experiments Demonstrate iiv14 Is Important in Soil Colonization
To be certain that the deletion of the iiv14 locus caused the reduced soil colonization, we used allele exchange to replace the deleted region with wildtype sequence. To achieve this, region 1092301–1093786 in the Pf0-1 genome, which spans iiv14, was cloned in pSR47s. The resulting plasmid was used in allele exchange as described [1]. Recombinants possessing wildtype sequence were confirmed by PCR. In soil colonization experiments, the replacement strain was indistinguishable from Pf0-1, confirming that the deletion was completely responsible for the colonization defect (data not shown).
Because the two genes iiv14 and Pfl_0939 overlap each other, deletion of one results in loss of the other. To test whether loss of iiv14 was sufficient to explain the soil colonization defect, we cloned the iiv14 ORF and upstream region into plasmid pME6000. Two versions of the complementation clone were constructed, one consisting of 1155bp upstream of the iiv14 ORF (called pME14CF1), and the other containing only 329bp of upstream sequence, including 169bp upstream of the iiv14 transcriptional start site (called pME14CF2) (Figure 3A). Neither of these clones includes the full-length Pfl_0939 coding sequence opposite iiv14. Thus, phenotypes attributed to the presence of the complementation clones are related to restoration of iiv14, not the opposite gene. P. fluorescens strains possessing the vector pME6000 grew slower than plasmid-free strains in soil. Therefore, complementation experiments were followed and analyzed on day two, rather than after one day in soil. The findings were compared to controls of Pf0-1 and Pf0-1Δiiv14 carrying the plasmid vector. As seen with plasmid-free strains (Figure 2), the Pf0-1(pME6000) population increased significantly more (about 10-fold; p<0.001) after one day than did the Pf0-1Δiiv14(pME6000) population (not shown). After two days, the Pf0-1(pME6000) population had increased more than the iiv14 mutant carrying pME6000 (p<0.05) (Figure 3B, column 1 and 2), verifying that the phenotypes associated with plasmid-free strains were true for plasmid-bearing strains. Both pME14CF1 and pME14CF2 complemented the defect in Pf0-1Δiiv14 (Figure 3B; compare column 2 with columns 3 and 4). Relative to Pf0-1Δiiv14 harboring the vector alone, the population of complemented strains increased significantly after two days in soil (p<0.005). To further test whether iiv14 or Pfl_0939 was important in soil colonization, the plasmid constructed for expression of His-tagged Pfl_0939 protein (pME0939His) was utilized in complementation experiments. This plasmid lacks the coding sequence for the first 12 amino acids of iiv14, so only Pfl_0939 protein is made. Unlike pME14CF1 and pME14CF2, the pME0939His failed to restore soil colonization, demonstrating that the defect is not due to the loss of Pfl_0939 (data not shown).
Figure 3. Restoring and enhancing soil colonization with multicopy clones of iiv14.
A. Organization of iiv14, Pfl_0939, Pfl_0940, and Pfl_0941 in the Pf0-1 genome. Horizontal lines below indicate the cloned regions in each complementation construct. Vertical dotted lines show the boundaries of the iiv14 ORF. The arrow indicates the location of the iiv14 transcription start site. From this it can be seen that the only clones possessing the full length iiv14 sequence are pME14CF1 and pME14CF2. B. Fold increase in population of the iiv14 mutant (Δiiv14) bearing complementing plasmids pME14CF1 and pME14CF2, compared to mutant and wild-type strains harboring vector pME6000, and compared to the iiv14 mutant harboring complementation plasmids with a stop codon replacing codon 17 of the gene, after two days growth in soil. The mutant Δiiv14 carrying complementing plasmids colonize significantly better than the mutant carrying the plasmid vector alone (pCF1, p<0.0005; pCF2, p<0.005). The mutant harboring plasmids carrying the nonsense codon (indicated by *) did not colonize significantly better than the mutant carrying the vector alone, and colonized significantly less than Pf0-1 harboring the vector (p<0.01). C. Effect of multiple copies of both iiv14 gene clones in Pf0-1 on soil colonization, relative to Pf0-1(pME6000). Population increases over 24 and 48 hours, are shown. The greater colonization shown by Pf0-1 carrying pCF1 or pCF2 was significant over the 48 hour colonization period (columns 4–6; p<0.05). In panels B and C, data points represent fold increases from individual experiments, horizontal lines represent median values. Pf0-1 and the iiv14 mutant are represented by circles and triangles, respectively. Inverted triangles represent strains in which the plasmid carries the stop codon at codon 17 of iiv14. Filled symbols show strains carrying pME6000 (vector), open symbols indicate carriage of complementing plasmids: pCF1 = pME14CF1; pCF2 = pME14CF2; stars show plasmids carrying stop codons at codon 17.
doi:10.1371/journal.pgen.1000094.g003As described above, deletion of iiv14 also removed 44 base pairs of the Pfl_0940 coding sequence. Plasmids pME14CF1 and pME14CF2 both contain the coding sequence for Pfl_0940 in addition to iiv14 (Figure 3A). To distinguish between the deletion of iiv14 and disruption of Pfl_0940 as the cause for the soil colonization defect, we constructed two additional complementation clones in pME6000, called pME940c1 and pME940c2, both of which include the full length of Pfl_0940, but not iiv14 or Pfl_0939. (Figure 3A). Neither of these clones was capable of restoring the soil growth phenotype of the iiv14/0939/0940 mutant (data not shown). Taken together, the complementation experiments using plasmid-based constructs demonstrate that of the three genes at the iiv14 locus, it is the non-predicted iiv14 that is important in colonization of soil, and was designated cosA.
A Nonsense Codon in cosA Abolishes Complementation
Having demonstrated that cosA is important for soil colonization, and that the gene specifies a protein, we created a nonsense mutation in the gene to determine whether it was the cosA-specified protein or some other feature of the sequence that was important for soil colonization. Codon 17 of the cosA gene was changed from AAG to TAG, after which the mutated DNA region was cloned to create plasmids that were identical to pME14CF1 and pME14CF2, apart from the nonsense mutation. The AAG to TAG change in cosA results in a silent change from leucine codon CTT to leucine codon CTA in the Pfl_0939 sequence on the opposite strand. In the sterile soil colonization assay, the mutation-containing plasmids were unable to complement the colonization defect, relative to Pf0-1(pME6000) (p<0.01) (Figure 3B, columns 5 and 6).
Multicopy cosA Clones Improve Soil Colonization
Deletion and complementation experiments (above) demonstrated that cosA specifies a soil colonization factor. Multiple copies of cosA (on the complementing plasmids) accelerated soil colonization by wild-type Pf0-1. After one day in sterile soil, the population of Pf0-1 carrying pME14CF1 increased significantly more than that of Pf0-1 carrying the vector alone (p<0.05) (Figure 3C, columns 1 and 2). Over the first two days in soil, the median increase of the Pf0-1(pME14CF1) population was more than 15 times that of Pf0-1(pME6000), while the median increase for Pf0-1(pME'14CF2) was about 10 times that of the control (p<0.05 for both) (Figure 3C, columns 4–6).
cosA Mutants Have a Competitive Defect
When Pf0-1ΔcosAkmr was introduced into sterile soil in competition with wild-type Pf0-1Smr, the mutant was not competitive during the first day, and was unable to increase its relative population over subsequent days (Figure 4). This result is in contrast to competitions between differently marked wild-type strains, where each makes up 50% of the soil population after co-inoculation with equal numbers (not shown). The proportion of Pf0-1ΔcosA in the population did not decline over time, confirming that the fitness defect of the mutant is confined to the early colonization period.
Figure 4. Soil competition experiments.
Pf0-1 and the cosA mutant strains marked with Smr (Pf0-1) or Kmr (ΔcosA) carried on miniTn7 were each diluted to contain approximately 104 cfu/mL. Soil was inoculated with 1mL of a 50:50 mix of each. Populations were monitored daily by cfu counting. Data shown are the average cfu/0.5 g soil, from four independent experiments. Error bars represent the standard error of the mean.
doi:10.1371/journal.pgen.1000094.g004Discussion Top
Our results demonstrate that there are at least six loci in P. fluorescens Pf0-1 at which both annotated (‘sense’) and ‘antisense’ DNA sequences are transcribed. Further investigation of a chosen example provided conclusive evidence for overlapping protein-coding genes specified opposite each other by the same stretch of DNA. Importantly, a role for this locus in soil colonization was identified, and of the two overlapping genes present, it was the novel non-predicted gene cosA that was required for efficient soil colonization.
These findings suggest that current genome annotations provide an incomplete view of the genetic potential of a given organism, a proposal that is not without precedent in prokaryotic biology. Genes specifying the small ncRNAs affect processes including transcriptional regulation, mRNA stability, and chromosome replication [15]. These are still difficult to predict ab initio in organisms for which there is little information on promoter consensus sequences, although new computational approaches have recently become available [16]. In the prokaryotic horizontally mobile elements, antisense RNA has long been known to control copy number in plasmids, and play a role in bacteriophage development [reviewed in 17]. For prokaryote chromosomal genes, both trans- and cis-encoded antisense RNA regulators are known: e.g. control of glnA in Clostridium acetobutylicum [18], ompF in E. coli [19], and the photosynthesis gene isiA in Synechocystis sp. PCC 6803 [13].
In eukaryotes, the concept that genomes include numerous sense/antisense gene pairs is becoming increasingly obvious with genome-wide transcriptional studies in yeast [8] and Arabidopsis [10]. Antisense transcripts have been implicated in eye development [20] and control of entry into meiosis in yeast [21]. However, discussion of antisense transcription is limited to possible regulatory roles for antisense RNA [e.g. 8], without consideration of the possibility that they may specify proteins. Genome annotations do not routinely predict the existence of two protein-coding genes on opposite DNA strands, and in fact normally deliberately eliminate predicted overlaps. Moreover, small protein-coding genes can be missed by predictive algorithms. For example, the blr gene in E. coli specifies a 41 residue protein, and was discovered in a sequence believed to be intergenic [22].
The fact that antisense genes have been implicated in important biological functions indicates that more attention should be given to this emerging class of genes. Because they are difficult to predict with existing algorithms, experimental techniques should be adapted to allow their inclusion in genome-wide surveys. Tiling array technology is not biased toward predicted genes, and thus can be used to reveal the existence of non-predicted transcripts, such as those found antisense to known genes. Proteomic studies using accurate mass tags have the capacity to identify any and all proteins produced by a given organism. If data from such experiments are analyzed in an unbiased way, proteins produced from non-predicted genes will be identified. Finally, genetic techniques such as the IVET approach that led to the discovery of the iiv sequences described here [1] are well-suited to the discovery of novel genes. We have argued previously [7] that the frequency with which antisense genes are detected by promoter trapping strongly suggests that they represent real genes. The added advantage of IVET-like experiments is that they provide information regarding up-regulation in a particular environment, which yields clues as to function.
The exact role for cosA in colonization of soil is currently unknown. The cosA deletion mutant has no growth defect in laboratory culture, yet is impaired in soil colonization. Pf0-1 strains possessing the complementing cosA containing plasmids are more rapid colonizers of soil than the control strains (Figure 3C), but do not grow faster than control strains in laboratory media. In fact, Pf0-1 carrying the plasmid pME14CF1 forms colonies on agar surfaces considerably less quickly than control strains.
Two proteins, SetA (20 kDa) and SetB (7 kDa), [23] are thought to be encoded opposite pic, which specifies a serine protease [24] on a pathogenicity island in Shigella flexneri serotype 2 strains [25],[26] and in enteroaggregative E. coli [24],[27]. Thus, this example of probable antisense protein-coding genes evolved in the context of a horizontally mobile element.
We have demonstrated that at one sense/antisense chromosomal locus (cosA), both the predicted ‘sense’ gene (Pfl_0939) and the unpredicted ‘antisense’ gene cosA specify proteins, and it is the non-predicted gene identified initially from gene-expression in soil studies which is important for colonization of soil in a model laboratory system. Thus, antisense genes may be more functionally diverse than simply making regulatory or antisense RNAs. The cosA/Pfl_0939 pair is the first demonstration of overlapping antisense protein-coding genes in a prokaryote genome.
Materials and Methods Top
Bacterial Strains and Plasmids
Pseudomonas fluorescens Pf0-1 was used as wild-type [28]. The genome sequence of Pseudomonas fluorescens Pf0-1 is available under GenBank accession number CP000094. Pf0-1Δiiv14/cosA was made by deleting bases 1092441 to 1093457 in the Pf0-1 genome by SOE-PCR [14] and allele exchange using plasmid pSR47s [29], as described [1]. E. coli DH5α (F- φ80lacZΔM15 Δ(lacZYA-argF) U169 recA1 endA1 hsdR17 (rk−, mk+) phoA supE44 λ- thi-1 gyrA96 relA1) (Invitrogen, Carlsbad, CA) was used to propagate plasmids. E. coli S17-1 (recA pro hsdR RP4-2-Tc::Mu-Km::Tn7 λ-pir) [30] served as the donor strain in conjugations. P. fluorescens strains were grown in PMM [31] at 30°C, and E. coli strains were grown in LB at 37°C. Plasmid pME6000 [32] was used for complementation studies and to express His-tagged proteins. Streptomycin resistant miniTn7 was constructed by inserting a Smr cassette from pHRP315 [33] into pUCT-mTn7T [34], while kanamycin resistant MiniTn7 is carried on pHRB2 [35]. MiniTn7 constructs were used to introduce Kmr and Smr markers into P. fluorescens strains for competition experiments, as described [36]. Complementation plasmids pME14CF1 and pME14CF2 contain regions 1092301–1094612 and 1092301–1093786 of the Pf0-1 genome, respectively. Plasmids pME940c1 and pME940c2 contain regions 1093208–1093627 and 1093208–1093786, respectively. Plasmid pME14His contains bases 1092438–1094204 of the Pf0-1 genome, and has codons for 6-His introduced immediately upstream of the cosA stop codon. Plasmid pME0939His contains bases 1091084–1093421 of the Pf0-1 genome and has codons for 6-His introduced immediately upstream of the Pfl_0939 stop codon. Pf0-1 sequences in each clone were amplified by PCR. In both cases, the six histidine codons were added by inclusion in the 3′ primer used to amplify the desired sequences.
DNA Manipulation and Sequencing
Recombinant DNA techniques were carried out as described [37]. Restriction and DNA modifying enzymes were purchased from Invitrogen Inc and New England Biolabs (Beverly, MA). Plasmid DNA was purified using the Qiaprep spin miniprep kit (Qiagen, Valencia, CA). Genomic DNA was prepared using Promega's Wizard Genomic DNA purification kit (Madison, WI). DNA was recovered from agarose gel slices using the Qiaex II gel extraction kit (Qiagen). PCR was carried out with Invitrogen Platinum Taq DNA polymerase High Fidelity. PCR products were cloned with pGEM-T Easy (Promega). Oligonucleotides were purchased from IDT (Coralville, IA) and DNA sequences were determined at the Tufts University Core Facility (Boston, MA).
Introduction of Nonsense Codon into cosA
The complementing regions from pME14CF1 and pME14CF2 were cloned into plasmid pHRB2, which is smaller than the pME6000 vector. Codon 17 was changed from AAG to TAG. This also causes a silent change from leucine codon CTT to leucine codon CTA in Pfl_0939. The nonsense mutation was introduced using the “round the horn” protocol as described (http://openwetware.org/wiki/'Round-the-horn_site-directed_mutagenesis). The DNA polymerase used was KOD Hot Start DNA polymerase (Novagen). Primers used were 14mutF (tgggcTagtccttcgggcttg), which contains the base change to create the nonsense mutation (upper case), and 14wtR2 (tgcctcgtgaaatcgccttcc). The nonsense mutation was verified in resulting plasmids by DNA sequencing. Two mutants of each complementing region were then each recloned into pME6000, and the DNA sequence was again verified. Each of the four resulting plasmids (two for each of CF1 and CF2) were transferred to Pf0-1ΔcosA, and then assessed for complementing ability in the soil assay as described below.
Soil Growth and Survival
Soil growth and survival assays were carried out as described previously [1] using gamma-irradiated, sandy loam soil, of known composition [38]. Briefly, cultures were grown for 16 hours in minimal medium, and diluted to contain approximately 104 cfu/mL. One mL of diluted culture was mixed with 5 g of soil, achieving approximately 50% water-holding capacity. Cultures for competition experiments in soil were adjusted to equal A600 values prior to dilution and then 500 µL of each competitor were used to inoculate soil as above. Population increase was monitored over time by extraction of cells and cfu determination by colony counting on selective media.
RNA Isolation and RT-PCR
P. fluorescens Pf0-1 RNA was isolated using an RNeasy Mini Kit, including the on-column DNaseI treatment (Qiagen). The RNA was then treated with RQ1 DNaseI (Promega) for 1h at 37°C, and re-purified using a Qiagen RNeasy column. For RT-PCR experiments, cDNA was synthesized from 500 ng of total RNA using Superscript III (Invitrogen) and a gene specific primer, at 52°C for 1 h. The cDNA was amplified by PCR using the gene specific primer, and an appropriate partner primer. All RT-PCR experiments were carried out with a negative control consisting of a reverse transcriptase-free reaction.
5′ RACE
5′ RACE was carried out using Invitrogen 5′ RACE system as recommended. Gene specific primers were 14RT-R (5′-ggcctgctgatctttttcag), 14GSP2 (5′-tgttcctgcaaccgaattcg), and 14GSP3 (5′-gggtgaaaagctacctgcac). Products were cloned in pGEM-T Easy, and sequenced using T7 and SP6 primers.
Protein Purification and Western Blotting
Proteins specified by cosA and Pfl_0939 were modified by addition of six histidine codons immediately before the stop codon, by PCR. In all cases, cultures were grown to A600 = 0.4, in PMM. His-tagged CosA protein was extracted and purified from P. fluorescens Pf0-1 carrying plasmid pME14His, using denaturing conditions, as described for E. coli in the QIAexpressionist handbook (Qiagen). Amicon Ultra-4 (10k) (Millipore, Billerica, MA) centrifugal filters were used to concentrate proteins. His-tagged Pfl_0939 was extracted from Pf0-1 carrying plasmid pME0939His, by sonication of cells, and solubilization in SDS buffer [37], resulting in a crude extract which was used in the western blots. Controls for each extraction (Pf0-1 carrying vector alone) were processed in the same way as each experimental preparation.
For western blot analysis, proteins were separated by SDS-PAGE (12.5% acrylamide for CosA-His protein, and 10% for Pfl_0939-His) and transferred to PolyScreen PVDF membrane (Perkin Elmer, Waltham, MA) using a Biorad Mini Trans-blot Cell (70 V, 1 h). Membranes were processed for immunodetection as described (QIAexpress Detection and Assay Handbook). Mouse monoclonal anti-polyHistidine antibody (Sigma, St. Louis, MO) was diluted 1:10000 in fresh TTBS (17.2 mM NaCl, 5.1 mM KCl, 24.8 mM tris base, 22 mM HCl (to pH 7.4), 0.1% Tween 20)+3% BSA. HRP-linked antimouse IgG antibody (Cell Signaling Technology, Danvers, MA) secondary antibody was diluted 1:10000 in TTBS plus 10% non-fat milk powder. Detection of antibodies was carried out using Western Lightning Western Blot Chemiluminescence Reagent Plus (Perkin Elmer). Luminescence was detected with Kodak BioMax MR film after 18 h of exposure. Protein molecular weights were estimated by comparison to the BenchMark Pre-Stained Protein Ladder (Invitrogen).
Statistical Analysis
Data from soil experiments were analyzed by the Mann Whitney test using GraphPad Prism 4 software.
Supporting Information Top
RT-PCR at the rpoS locus using strand-specific primers. Using the same method as was used for the sense/antisense pairs, we carried out RT-PCR at the rpoS locus as a negative control. In contrast to the sense/antisense pairs shown in Figure 1, transcription could only be detected from the annotated (rpoS) gene, and not from the opposite DNA strand, indicating that this approach successfully discriminates between loci in which one or both strands are transcribed.
(4.04 MB TIF)
Mapping the iiv14/cosA transcript. A. Location of the iiv14/cosA transcription start site (+1), identified by 5′RACE, relative to a predicted ORF in the Pf0-1 genome (bases 1093457–1092441) (shaded arrow). Also shown are the approximate locations of the primers (F and R) used to show transcription by RT-PCR. The vertical bar at the 3′ end indicates an arbitrary downstream boundary for searching for the transcription terminator. B. Region from base 1180 to 1503, relative to the +1 site. Gene specific RT-PCR primers 1–4, used to map the 3′ end of iiv14/cosA, are shown. C. RT-PCR to map the 3′ end of the iiv14/cosA transcript. RT was carried out with gene specific primers 1–4, followed by PCR with the gene specific primer and primer ‘F’. RT-PCR products are in lanes marked ‘+’, reverse transcriptase-free negative controls are in ‘−’ lanes, while the ‘C’ lanes show positive control PCR using genomic DNA as the template. D. Region 1374–1434, showing the DNA sequence of a putative transcriptional terminator identified by TransTerm. The ‘t’ underlined in the left stem (arrowed) does not match, and is predicted to bulge out of the stem.
(3.51 MB TIF)
Acknowledgments Top
We thank Julie Nicoll for help with protein purification, Katherine Corso for advice on statistical analysis, and Andrew Wright for comments on the manuscript.
Author Contributions Top
Conceived and designed the experiments: MS SL. Performed the experiments: MS. Analyzed the data: MS SL. Contributed reagents/materials/analysis tools: MS. Wrote the paper: MS SL.
References Top
- (2004) Use of IVET to identify genes important in growth and survival of Pseudomonas fluorescens Pf0-1 in soil: discovery of expressed sequences with novel genetic organization. J Bacteriol 186: 7411–7419. Find this article online
- (1999) Adaptation of Pseudomonas fluorescens to the plant rhizosphere. Environ Microbiol 1: 243–257. Find this article online
- (2004) Ralstonia solanacearum genes induced during growth in tomato: an inside view of bacterial wilt. Mol Microbiol 53: 1641–1660. Find this article online
- (1995) Use of recombinase gene fusions to identify Vibrio cholerae genes induced during infection. Mol Microbiol 18: 671–683. Find this article online
- (2003) Genes encoding a cellulosic polymer contribute toward the ecological success of Pseudomonas fluorescens SBW25 on plant surfaces. Mol Ecol 12: 3109–3121. Find this article online
- (1993) Selection of bacterial virulence genes that are specifically induced in host tissues. Science 259: 686–688. Find this article online
- (2004) IVET experiments in Pseudomonas fluorescens reveal cryptic promoters at loci associated with recognizable overlapping genes. Microbiology 150: 518–520. Find this article online
- (2006) A high-resolution map of transcription in the yeast genome. Proc Natl Acad Sci USA 103: 5320–5325. Find this article online
- (2006) Genome-wide transcription analyses in rice using tiling microarrays. Nat Genet 38: 124–129. Find this article online
- (2005) Identification of transcribed sequences in Arabidopsis thaliana by using high-resolution genome tiling arrays. Proc Natl Acad Sci USA 102: 4453–4458. Find this article online
- (2003) Empirical Analysis of Transcriptional Activity in the Arabidopsis Genome. Science 302: 842–846. Find this article online
- (1993) Antisense transcription of the ftsZ-ftsA gene junction inhibits cell division in Escherichia coli. J Bacteriol 175: 7097–7101. Find this article online
- (2006) An internal antisense RNA regulates expression of the photosynthesis gene isiA. Proc Natl Acad Sci USA 103: 7054–7058. Find this article online
- (1989) Engineering hybrid genes without the use of restriction enzymes: gene splicing by overlap extension. Gene 77: 61–68. Find this article online
- (2002) An Expanding Universe of Noncoding RNAs. Science 296: 1260–1263. Find this article online
- (2005) sRNAPredict: an integrative computational approach to identify sRNAs in bacterial genomes. Nucl Acids Res 33: 4096–4105. Find this article online
- (1994) Antisense RNA control in bacteria, phages, and plasmids. Annu Rev Microbiol 48: 713–742. Find this article online
- (1990) Studies on Clostridium acetobutylicum glnA promoters and antisense RNA. Mol Microbiol 4: 1575–1583. Find this article online
- (1984) A unique mechanism regulating gene expression: translational inhibition by a complementary RNA transcript (micRNA). Proc Natl Acad Sci USA 81: 1966–1970. Find this article online
- (2005) Natural antisense transcripts associated with genes involved in eye development. Hum Mol Genet 14: 913–923. Find this article online
- (2006) Antisense transcription controls cell fate in Saccharomyces cerevisiae. Cell 127: 735–745. Find this article online
- (2000) ‘Intergenic’ blr gene in Escherichia coli encodes a 41-residue membrane protein affecting intrinsic susceptibility to certain inhibitors of peptidoglycan synthesis. Mol Microbiol 37: 364–370. Find this article online
- (1995) Shigella enterotoxin 1: an enterotoxin of Shigella flexneri 2a active in rabbit small intestine in vivo and in vitro. J Clin Invest 95: 2853–2861. Find this article online
- (1999) Characterization of Pic, a secreted protease of Shigella flexneri and enteroaggregative Escherichia coli. Infect Immun 67: 5587–5596. Find this article online
- (2001) Genetic organization of the she pathogenicity island in Shigella flexneri 2a. Microb Pathog 30: 1–8. Find this article online
- (1997) Use of a novel approach, termed island probing, identifies the Shigella flexneri she pathogenicity island which encodes a homolog of the immunoglobulin A protease-like family of proteins. Infect Immun 65: 4606–4614. Find this article online
- (1999) Phylogenetic analysis of enteroaggregative and diffusely adherent Escherichia coli. Infect Immun 67: 2692–2699. Find this article online
- (1988) Survival of rifampin-resistant mutants of Pseudomonas fluorescens and Pseudomonas putida in soil systems. Appl Environ Microbiol 54: 2432–2438. Find this article online
- (2000) Identification and subcellular localization of the Legionella pneumophila IcmX protein: a factor essential for establishment of a replicative organelle in eukaryotic host cells. Infect Immun 68: 3971–3982. Find this article online
- (1983) A broad host range mobilisation system for in vivo engineering: Transposon mutagenesis in gram-negative bacteria. Biotechnology 1: 748–751. Find this article online
- (1996) The non-haem chloroperoxidase from Pseudomonas fluorescens and its relationship to pyrrolnitrin biosynthesis. Microbiology 142: 2129–2135. Find this article online
- (1998) Salicylic acid biosynthetic genes expressed in Pseudomonas fluorescens strain P3 improve the induction of systemic resistance in tobacco against tobacco necrosis virus. Phytopathology 88: 678–684. Find this article online
- (1993) Construction and use of a new broad-host-range lacZ transcriptional fusion vector, pHRP309, for Gram- bacteria. Gene 133: 23–30. Find this article online
- (2005) A Tn7-based broad-range bacterial cloning and expression system. Nat Methods 2: 443–448. Find this article online
- (2007) Phosphate-dependent modulation of c-di-GMP levels regulates Pseudomonas fluorescens Pf0-1 biofilm formation by controlling secretion of the adhesin LapA. Mol Microbiol 63: 656–679. Find this article online
- (2003) GacS sensor domains pertinent to the regulation of exoproduct formation and to the biocontrol potential of Pseudomonas fluorescens CHA0. Mol Plant Microbe Interact 16: 634–644. Find this article online
- (2001) Molecular cloning: a laboratory manual. Cold Spring Harbor, New York: Cold Spring Harbor Laboratory Press.
- (1990) Development of an adhesion assay and characterization of an adhesion-deficient mutant of Pseudomonas fluorescens. Appl Environ Microbiol 56: 112–119. Find this article online

Add a note to this text.
Post Your Note (For Public Viewing)