Advertisement
Research Article

Genetic Analysis of Floral Symmetry in Van Gogh's Sunflowers Reveals Independent Recruitment of CYCLOIDEA Genes in the Asteraceae

  • Mark A. Chapman,

    Affiliation: Department of Plant Biology, University of Georgia, Athens, Georgia, United States of America

    Current address: Department of Plant Sciences, University of Oxford, Oxford, United Kingdom

    X
  • Shunxue Tang,

    Affiliation: Institute of Plant Breeding, Genetics, and Genomics, University of Georgia, Athens, Georgia, United States of America

    Current address: Dow AgroSciences, Indianapolis, Indiana, United States of America

    X
  • Dörthe Draeger,

    Affiliation: Institute of Plant Breeding, Genetics, and Genomics, University of Georgia, Athens, Georgia, United States of America

    X
  • Savithri Nambeesan,

    Affiliation: Department of Plant Biology, University of Georgia, Athens, Georgia, United States of America

    X
  • Hunter Shaffer,

    Affiliation: Department of Plant Biology, University of Georgia, Athens, Georgia, United States of America

    X
  • Jessica G. Barb,

    Affiliation: Institute of Plant Breeding, Genetics, and Genomics, University of Georgia, Athens, Georgia, United States of America

    X
  • Steven J. Knapp,

    Affiliation: Institute of Plant Breeding, Genetics, and Genomics, University of Georgia, Athens, Georgia, United States of America

    Current address: Monsanto Company, Woodland, California, United States of America

    X
  • John M. Burke mail

    jmburke@uga.edu

    Affiliation: Department of Plant Biology, University of Georgia, Athens, Georgia, United States of America

    X
  • Published: March 29, 2012
  • DOI: 10.1371/journal.pgen.1002628

Reader Comments (2)

Post a new comment on this article

In double-flowered (dbl) mutants of sunflower, the insertion upstream the start codon of a CYCLOIDEA-like gene (HaCYC2c) is a deletion-derivate CACTA-like transposable element (TE)

Posted by Claudio1 on 25 Jun 2012 at 10:45 GMT

In sunflower (Helianthus annuus) mutants characterized by disk flower’s corolla viewing a monosymmetric ray-like aspect [double-flowered (dbl) mutants], Chapman et al. (2012) identified a 999 bp insertion upstream the start codon of a CYCLOIDEA-like gene (HaCYC2c). Among other things, their data strongly suggest that this insertion alters HaCYC2c expression and it is essential to generate the dbl phenotype. This mutant is apparently very old (Cockerell 1915; Heiser 1976), and is also represented in a famous Van Gogh’s oil on canvas. Chapman et al. (2012) stated that: “The 999 bp upstream insertion showed no hallmarks of being a transposon or other mobile DNA element”. We disagree with this assertion. An analysis performed on this 999 bp insertion, in homozygous and heterozygous dbl genotypes (Genbank accession numbers: JF489910, JF489912, JF489913, HQ891027 and HQ891028), suggests that it belongs to the large family of transposable element (TE) called CACTA or Enhancer/Suppressor-mutator (En/Spm) (Pereira et al. 1986).
The 999 bp insertion of the HaCYC2c gene is identical in all analysed genotypes and it is apparently deletion-derivative TE because it is lacking of obvious coding capacity [e.g., coding sequence (CDS) for a transposase-like protein]. Indeed, the insertion displays some clear CACTA signatures: i) it is flanked by short (12 bp, 5’-CACTACAAGAAA-3’) terminal inverted repeats (TIRs) that terminate with conserved and intact 5’-CACTA-3’ motifs that serve as recognition sequences for the transposase protein (Lewin 1997); ii) a ClustalW analysis (Thompson et al. 1994) between wild type (cmsHA89, Genbank accession number HQ891026) and dbl mutant (Sunglod Tall, Genbank accession number JF489913) sequences shows that the 999 bp insertion is composed by the CACTA insertion (996 bp) and a perfect three bp (GAT) target-site duplication (TSD), characteristic of this TE family; iii) it contains several sub-terminal repeats (sub-TRs) that are repeated in direct and inverted orientation, characteristic of CACTA elements (Wicker et al. 2003).
The sub-TRs and inverted repeats display a specific pattern when the CACTA sequence is plotted against itself with dot plot (program DOTTER; Sonnhammer and Durbin 1995). For example, a 102 bp duplicated region (5’- TTTTTAATCAATGGTCAGCAGCAAATCTTGTAGAAGCACACGGATCGGGCTTTTAGCGGCGACAGCAATAGCGGCGACAAAGAGCCTTTAGCGGCGACGCGT-3’) next to the 3’-TIR is well-identifiable. Small sub-TRs that are repeated in direct and inverted orientation are also interspersed within this large duplication.
We suggest that the 999 bp insertion, upstream the start codon of the HaCYC2c gene, found by Chapman and co-workers (2012), is a truncated version of a TE, likely generated from an imperfect excision of an entire element. For its small size the insertion should be designed as a small non autonomous CACTA (SNAC) (Wicker et al. 2003).

REFERENCES
Chapman MA, Tang S, Draeger D, Nambeesan S, Shaffer H, et al. (2012) Genetic analysis of floral symmetry in Van Gogh's sunflowers reveals independent recruitment of CYCLOIDEA genes in the Asteraceae. PloS Genet 8 (3) e1002628. doi:10.1371/journal.pgen.1002628.
Cockerell TDA (1915) Specific and varietal characters in annual sunflowers. Am Natur 49: 609-622. http://www.jstor.org/stab....
Heiser CB Jr (1976) The Sunflower. Norman: University of Oklahoma Press.
Lewin B (1997) Transposons. In: Lewin B, editor, Genes VI. New York: Oxford University Press, Inc. pp. 563-595.
Pereira A, Cuypers H, Gierl A, Sommer ZS, Saedler H (1986) Molecular analysis of the En/Spm transposable element system of Zea mays. EMBO J 5: 835-841.
Sonnhammer ELL, Durbin R (1995) A dot-matrix program with dynamic threshold control suited for genomic DNA and protein sequence analysis. Gene Combis 167: GC1–GC10.
Thompson JD, Higgins DG, Gibson TJ (1994) CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res 22: 4673-4680.
Wicker T, Guyot R, Yahiaoui N, Keller B (2003) CACTA transposons in Triticeae. A diverse family of high-copy repetitive elements. Plant Physiol 132: 52-63. www.plantphysiol.org/cgi/....

Authors:

Claudio Pugliesi, Università di Pisa, Dipartimento di Biologia delle Piante Agrarie, Via Matteotti 1B, I-56124 Pisa, Italy.

Marco Fambrini, Università di Pisa, Dipartimento di Biologia delle Piante Agrarie, Via Matteotti 1B, I-56124 Pisa, Italy.

Mariangela Salvini, Scuola Normale Superiore, Piazza dei Cavalieri 7, I-56126 Pisa, Italy.

No competing interests declared.